RP4-792G4.2

Species: Homo sapiens

Position: chr1: 63320883-63324441

Known as:

Transcript: ENST00000427268

Sequence: Download

Description:

We developed a CRISPR interference (CRISPRi) platform targeting 16,401 lncRNA loci in seven diverse cell lines, including six transformed cell lines and human induced pluripotent stem cells (iPSCs). We classified lncRNA genes as hits if their combined phenotype effect size and P value (referred to here as “screen score”) exceeded a consistent threshold applied to each screen corresponding to an empirical FDR of 5%. Large-scale screening identified 499 lncRNA loci required for robust cellular growth, of which 89% showed growth modifying function exclusively in one cell type.



sgRNAs

sgRNA_ID Sequence Position (Chr) Position (Lnc) Length PAM Type Validity Cell line Note Ref.
sgRNA1 GCCGACTGCACGGTCCCGGG 63324316-63324335(-) gene body (near 5') 20 TGG CRISPRi Partial validated iPSC NA [1]
sgRNA2 TGCGGGCTGCAGAAACTGTC 63324419-63324438(-) gene body (near 5') 20 CGG CRISPRi Partial validated iPSC NA [1]
sgRNA3 TGCAGAAACTGTCCGGAGAG 63324412-63324431(-) gene body (near 5') 20 TGG CRISPRi Partial validated iPSC NA [1]
sgRNA4 ATCGAGAACATCATAGGTGG 63324196-63324215(+) gene body (near 5') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA5 GAGAGTGGCACGCTAAGAAT 63324397-63324416(-) gene body (near 5') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA6 TTCAGCATCGAGAACATCAT 63324190-63324209(+) gene body (near 5') 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA7 AGCATCGAGAACATCATAGG 63324193-63324212(+) gene body (near 5') 20 TGG CRISPRi Partial validated iPSC NA [1]
sgRNA8 CGAGGGCAGCAGCGGCACAG 63324008-63324027(-) gene body (near 5') 20 CGG CRISPRi Partial validated iPSC NA [1]
sgRNA9 CACGCTAAGAATGGGCGCGA 63324389-63324408(-) gene body (near 5') 20 TGG CRISPRi Partial validated iPSC NA [1]
sgRNA10 GCGCGATGGTGGCAGTCGTC 63324375-63324394(-) gene body (near 5') 20 CGG CRISPRi Partial validated iPSC NA [1]

GBrowser


Links

lncRNA Function:

sgRNA Design Tool:

Reference

1. Liu SJ, Horlbeck MA, Cho SW, Birk HS, Malatesta M, et al. (2017). CRISPRi-based genome-scale identification of functional long noncoding RNA loci in human cells. Science 355(6320).