RP5-1024G6.2

Species: Homo sapiens

Position: chr1: 53210455-53213775

Known as:

Transcript: ENST00000452466

Sequence: Download

Description:

We developed a CRISPR interference (CRISPRi) platform targeting 16,401 lncRNA loci in seven diverse cell lines, including six transformed cell lines and human induced pluripotent stem cells (iPSCs). We classified lncRNA genes as hits if their combined phenotype effect size and P value (referred to here as “screen score”) exceeded a consistent threshold applied to each screen corresponding to an empirical FDR of 5%. Large-scale screening identified 499 lncRNA loci required for robust cellular growth, of which 89% showed growth modifying function exclusively in one cell type.



sgRNAs

sgRNA_ID Sequence Position (Chr) Position (Lnc) Length PAM Type Validity Cell line Note Ref.
sgRNA1 GCTGTTCATGACAACTGGAT 53213461-53213480(+) gene body (near 5') 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA2 AGCAGCCCAGCAGTGAACCT 53213395-53213414(+) gene body (near 5') 20 TGG CRISPRi Partial validated iPSC NA [1]
sgRNA3 CCGGGCATTGCGGCCTGGGT 53213501-53213520(-) gene body (near 5') 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA4 TCTACCTGGACCCTGCATAC 53213336-53213355(+) gene body (near 5') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA5 TCTGCCCGTATGCAGGGTCC 53213343-53213362(-) gene body (near 5') 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA6 GGAGAAACTCCCGGGCATTG 53213511-53213530(-) gene body (near 5') 20 CGG CRISPRi Partial validated iPSC NA [1]
sgRNA7 CCGGGAGTTTCTCCAATGTG 53213517-53213536(+) gene body (near 5') 20 TGG CRISPRi Partial validated iPSC NA [1]
sgRNA8 AGCCCAGCAGTGAACCTTGG 53213398-53213417(+) gene body (near 5') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA9 CTCAGGCAAGATGATCCCTT 53213315-53213334(-) gene body (near 5') 20 TGG CRISPRi Partial validated iPSC NA [1]
sgRNA10 CTAAGGCCTTCTCCACACAT 53213532-53213551(-) gene body (near 5') 20 TGG CRISPRi Partial validated iPSC NA [1]

GBrowser


Links

lncRNA Function:

sgRNA Design Tool:

Reference

1. Liu SJ, Horlbeck MA, Cho SW, Birk HS, Malatesta M, et al. (2017). CRISPRi-based genome-scale identification of functional long noncoding RNA loci in human cells. Science 355(6320).