Rffl-lnc1
Species: Rattus norvegicus
Position: chr10: 70186284-70189684
Known as:
Transcript: Rffl-lnc1
Sequence: Download
Description:
Rffl-lnc1 located within the coding gene Rffl 5'-UTR intronic region, and is deemed as a genetic determinant of QT-interval and blood pressure. Targeted disruption of the rat Rffl-lnc1 locus caused aberrant, short QT-intervals and elevated blood pressure. Further, to specifically examine the significance of the 19bp polymorphism within the Rffl-lnc1 locus, a CRISPR/Cas9 based targeted knock-in rescue model was constructed by inserting the 19bp into the strain which contained the deletion polymorphism. The knock-in alleles successfully rescued the aberrant QT-interval and blood pressure phenotypes. Further studies revealed that the 19bp polymorphism was necessary and sufficient to recapitulate the phenotypic effect of the previously mapped <42.5kb quantitative trait loci (QTLs) in the rat genome.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | AAGCCATGGAGTTAGGCCAT | 70188105-70188124(-) | gene body (near 5') | 20 | AGG | CRISPRki | High activity | embryo | 21 out of these 67 pups were mutants | [1] |
GBrowser
Links
Reference
1. Cheng X, Waghulde H, Mell B, Morgan EE, Pruett-Miller SM, et al. (2017). Positional cloning of quantitative trait nucleotides for blood pressure and cardiac QT-interval by targeted CRISPR/Cas9 editing of a novel long non-coding RNA. PLoS Genet 13(8): e1006961.
