Riken-201
Species: Mus musculus
Position: chr13: 83721380-83741308
Known as: C130071C03Rik , ENSMUSG00000050334
Transcript: NR_152244 , NR_152245 , NR_015561 , NR_152246 , ENSMUST00000131907 , ENSMUST00000182788 , ENSMUST00000182701
Sequence: Download
Description:
LncRNA C130071C03Riken variants Riken-201 (Riken-201) and Riken-203 (Riken-203) are both expressed highly in brain, and increase gradually during neural differentiation. Repression of Rik-201 and Rik-203 inhibited neural differentiation from mouse embryonic stem cells. Moreover, Rik-201 and Rik-203 functioned as the competing endogenous RNA (ceRNA) to repress the function of miR-96 and miR-467a-3p, respectively, and modulate the expression of Sox6 to further regulate neural differentiation. Knockout of the Rik-203 and Rik-201 induced high ratio of brain developmental retardation. C/EBPb might potentially activated the transcription of Rik-201 and Rik-203.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| Rik_sgRNA1 | CAATAAAAGGCGATCGCTCC | 83729648-83729667(+) | gene body (near 5') | 20 | AGG | CRISPRko | Experimental validated | embryo | edit with Riken-203 | [1] |
| Rik_sgRNA2 | TAACCGAGATGCGACCTTCG | 83733384-83733403(+) | gene body (near 3') | 20 | TGG | CRISPRko | Experimental validated | embryo | edit with Riken-203 | [1] |
GBrowser
Links
Reference
1. Zhang L, Xue Z, Yan J, Wang J, Liu Q, et al. (2019). LncRNA Riken-201 and Riken-203 modulates neural development by regulating the Sox6 through sequestering miRNAs. Cell Prolif 52(3): e12573.
