SLC25A25-AS1
Species: Homo sapiens
Position: chr9: 128108580-128118734
Known as: SLC25A25-AS1 , ENSG00000234771
Transcript: NR_033374 , ENST00000418747
Sequence: Download
Description:
Loss-of-function (LOF) methods such as RNA interference (RNAi), antisense oligonucleotides or CRISPR-based genome editing provide unparalleled power for studying the biological function of genes. However, depletion of lncRNA with unknown function using different LOF methods can lead to different biological conclusions. SLC25A25-AS1 was choosed as a spliced and intragenic lncRNA with three promoters and a single 3' polyadenylation site. Among all ENCODE cell lines, SLC25A25-AS1 was most highly expressed in the nucleus of HeLa cells. The genomic locus was actively transcribed based on the presence of both histone H3 lysine 4 trimethylated (H3K4me3) and histone H3 lysine 27 acetylated (H3K27ac) histones at the predicted SLC25A25-AS1 locus. Both LNA oligonucleotides and CRISPRi guides achieved over 50% depletion. But, we observed a signifcant mitotic delay after LNA-mediated knockdown of SLC25A25-AS1, whereas no such effect was observed with the CRISPRi-based methods.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | GATGGAGAATGTAAGGGTAC | 128118725-128118744(+) | gene body (near 5') | 20 | AGG | CRISPRi | Experimental validated | Hela | NA | [1] |
| sgRNA2 | TGCAGAGAACGGAGGCATGC | 128118678-128118697(+) | gene body (near 5') | 20 | AGG | CRISPRi | Experimental validated | Hela | NA | [1] |
GBrowser
Links
Reference
1. Stojic L, Lun ATL, Mangei J, Mascalchi P, Quarantotti V, et al. (2018). Specificity of RNAi, LNA and CRISPRi as loss-of-function methods in transcriptional analysis. Nucleic Acids Res.
