SNHG15
Species: Homo sapiens
Position: chr7: 44983022-44986834
Known as: SNHG15 , ENSG00000232956
Transcript: NR_152597 , NR_152594 , NR_152595 , NR_003697 , NR_152596 , ENST00000578968
Sequence: Download
Description:
SNHG15 is a potentially oncogenic lncRNA that encodes a snoRNA in one of its introns. The processed SNHG15 is overexpressed in CRC tumors and its expression is highly correlated with poor survival of patients. Interestingly, SNHG15 is more highly expressed in tumors with high levels of MYC expression, while MYC protein binds to two Ebox motifs on SNHG15 sequence, indicating that SNHG15 transcription is directly regulated by the oncogene MYC. SNHG15 plays an important role in promoting colon cancer and mediating drug resistance, suggesting its potential as prognostic marker and target for RNA-based therapies.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | AAGACCCTGCGTCTTCTTGA | 44982959-44982978(-) | down stream | 20 | AGG | CRISPRko | Experimental validated | LoVo | paried with sgRNA2 | [1] |
| sgRNA2 | CCTGTGTTCCTCTGGGTGGT | 44984478-44984497(-) | gene body (near 3') | 20 | GGG | CRISPRko | Experimental validated | LoVo | paried with sgRNA1 | [1] |
GBrowser
Links
Reference
1. Saeinasab M, Bahrami AR, González J, Marchese FP, Martinez D, et al. (2019). SNHG15 is a bifunctional MYC-regulated noncoding locus encoding a lncRNA that promotes cell proliferation, invasion and drug resistance in colorectal cancer by interacting with AIF. J Exp Clin Cancer Res 38(1): 172.
