STOX2-IT3-lncRNA
Species: Homo sapiens
Position: chr4: 184014034-184016382
Known as:
Transcript: AK098131
Sequence: Download
Description:
STOX2-IT3-lncRNA is located within the intron 3 of the STOX2 gene on 4q35.1, and acts as a permissive cis-acting regulator of alternative splicing of STOX2. When this lncRNA is mutated or absent, an alternative exon (3B) of STOX2 is included. This introduces a stop codon resulting in the deletion of a highly conserved domain of 64 amino acids in the C-terminal of the STOX2 protein. A mutation present within a regulatory region within intron 1 of STOX2 has the same effect after blocking with CRISPR technology: transcripts with exon 3B are upregulated. This process appears related to transcriptional control by a chromatin-splicing adaptor complex as described for FGFR2. For STOX2, CHD5, coding for a chromodomain helicase DNA binding protein, qualifies as the chromatin modifier in this process.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | TGCATGTGCGTTTGGTTCAC | 183997110-183997129(-) | up stream | 20 | TGG | CRISPRi | Experimental validated | SGHPL-5 | NA | [1] |
| sgRNA2 | GACAGTAAACTCGGCTGTGA | 183997147-183997166(+) | up stream | 20 | TGG | CRISPRi | Experimental validated | SGHPL-5 | NA | [1] |
| sgRNA3 | TAAACTCGGCTGTGATGGAA | 183997152-183997171(+) | up stream | 20 | TGG | CRISPRi | Designed by expert | SGHPL-5 | NA | [1] |
| sgRNA4 | GGGAGAGAAGACAGTAAACT | 183997138-183997157(+) | up stream | 20 | CGG | CRISPRi | Designed by expert | SGHPL-5 | NA | [1] |
| sgRNA5 | TGCATGTGTGCATGTGCGTT | 183997118-183997137(-) | up stream | 20 | TGG | CRISPRi | Designed by expert | SGHPL-5 | NA | [1] |
| sgRNA6 | AAACGCACATGCACACATGC | 183997117-183997136(+) | up stream | 20 | AGG | CRISPRi | Designed by expert | SGHPL-5 | NA | [1] |
| sgRNA7 | AACGCACATGCACACATGCA | 183997118-183997137(+) | up stream | 20 | GGG | CRISPRi | High activity | SGHPL-5 | reduced undesired off-target effects | [1] |
GBrowser
Links
Reference
1. Oudejans CB, Poutsma A, Michel OJ, Thulluru HK, Mulders J, et al. (2016). Noncoding RNA-regulated gain-of-function of STOX2 in Finnish pre-eclamptic families. Sci Rep 6: 32129.







