Spaar
Species: Mus musculus
Position: chr4: 43730033-43734534
Known as: Spaar , ENSMUSG00000028475
Transcript: NR_033355 , ENSMUST00000131248
Sequence: Download
Description:
The LINC00961-encoded SPAR polypeptide can regulate mTORC1 and muscle regeneration. This polypeptide is conserved between human and mouse, is localized to the late endosome/lysosome and interacts with the lysosomal v-ATPase to negatively regulate mTORC1 activation. This regulation of mTORC1 is specific to activation of mTORC1 by amino acid stimulation, rather than by growth factors. Hence, we termed this polypeptide's all regulatory polypeptide of amino acid response' (SPAR). The SPAR-encoding lncRNA is highly expressed in a subset of tissues and use CRISPR/Cas9 engineering to develop a SPAR-polypeptide-specific knockout mouse while maintaining expression of the host lncRNA. We find that the SPAR-encoding lncRNA is downregulated in skeletal muscle upon acute injury, and using this in vivo model we establish that SPAR downregulation enables efficient activation of mTORC1 and promotes muscle regeneration. Our data provide a mechanism by which mTORC1 activation may be finely regulated in a tissue-specific manner in response to injury, and a paradigm by which lncRNAs encoding small polypeptides can modulate general biological pathways and processes to facilitate tissue-specific requirements, consistent with their restricted and highly regulated expression profile.
sgRNAs
sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
---|---|---|---|---|---|---|---|---|---|---|
sgRNA1 | GGAGACCGCGGTGATTGGGA | 43730967-43730986(+) | gene body (near 5') | 20 | TGG | CRISPRko | Experimental validated | embryo | paried with sgRNA2 | [1] |
sgRNA2 | CTTGTCACACCGAACACGGT | 43730930-43730949(-) | gene body (near 5') | 20 | GGG | CRISPRko | Experimental validated | embryo | paried with sgRNA1 | [1] |
GBrowser
Links
Reference
1. Matsumoto A, Pasut A, Matsumoto M, Yamashita R, Fung J, et al. (2017). mTORC1 and muscle regeneration are regulated by the LINC00961-encoded SPAR polypeptide. Nature 541(7636): 228-232.