THOR
Species: Homo sapiens
Position: chr2: 118182921-118186386
Known as: LOC100506797 , ENSG00000226856
Transcript: NR_144530
Sequence: Download
Description:
THOR exhibits expression exclusively in testis and a broad range of human cancers, whose structure and function have undergone positive evolutionary selection. A THOR-knockout cell line model via CRISPR-Cas9 technology with paired sgRNAs targeted to the conserved region of THOR transcript in the H1299 cell line exhibited significantly reduced cell proliferation. THOR has a conserved interaction with IGF2BP1 and contributes to the mRNA stabilization activities of IGF2BP1, potentially promoting oncogenesis.
THOR is expressed in human renal cell carcinoma (RCC) tissues and established/primary human RCC cells, but neither in normal renal tissues nor in HK-2 and primary human renal epithelial cells. THOR silencing (by targeted siRNAs) or CRISPR/Cas9 knockout inhibited RCC cell growth, viability and proliferation in vitro. IGF2BP1-regulated genes, including IGF2, GLI1 and Myc, were downregulated by THOR silencing or knockout, but they were upregulated after THOR over-expression. In vivo, THOR-knockout 786-O tumors grew significantly slower than the control tumors in nude mice.
Lnc-THOR is exclusively expressed in human osteosarcoma (OS) cells and tissues, but not in the primary human osteoblasts, indicating its potential as a novel therapeutic target. siRNA-mediated knockdown or CRSIPR/Cas9-mediated knockout of Lnc-THOR significantly inhibited human OS cell survival and proliferation. IGF2BP1-targeting mRNAs, including IGF2, GLI1 and CD44, were downregulated in Lnc-THOR-silenced OS cells. In vivo, tumors derived from Lnc-THOR knockout U2OS cells grew significantly slower than the control U2OS tumors.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | AGGGTGTAGCGCGGGCTAGA | 118186524-118186543(-) | up stream | 20 | AGG | CRISPRko | High activity | NCI-H1299;U2OS | NA | [1] [2] |
| sgRNA2 | GTAGGTGCTGCCATGCCAG | 118186336-118186354(-) | gene body (near 5') | 19 | GGG | CRISPRko | High activity | NCI-H1299;U2OS | NA | [1] [2] |
| sgRNA3 | GTTCCAAGGTGCTTCTCTC | 118183269-118183287(-) | gene body (near 3') | 19 | TGG | CRISPRko | Experimental validated | NCI-H1299 | NA | [1] |
| sgRNA4 | TGAAATATTGATTTCTGTC | 118183145-118183163(+) | gene body (near 3') | 19 | TGG | CRISPRko | Experimental validated | NCI-H1299 | NA | [1] |
| sgRNA5 | TTCACACACCATAGAGAGG | 118183078-118183096(+) | gene body (near 3') | 19 | CGG | CRISPRko | Experimental validated | NCI-H1299 | NA | [1] |
| sgRNA6 | AGGGTGTAGCGCGGGCTAGA | 118186524-118186543(-) | up stream | 20 | AGG | CRISPRko | Experimental validated | 786-O;A498;ACHN | NA | [3] |
| sgRNA7 | GTAGGTGCTGCCATGCCAG | 118186336-118186354(-) | gene body (near 5') | 19 | GGG | CRISPRko | Experimental validated | 786-O;A498;ACHN | NA | [3] |
GBrowser
Links
Reference
1. Hosono Y, Niknafs YS, Prensner JR, Iyer MK, Dhanasekaran SM, et al. (2017). Oncogenic Role of THOR, a Conserved Cancer/Testis Long Non-coding RNA. Cell 171(7): 1559-1572.e20.
2. Chen W, Chen M, Xu Y, Chen X, Zhou P, et al. (2018). Long non-coding RNA THOR promotes human osteosarcoma cell growth in vitro and in vivo. Biochem Biophys Res Commun 499(4): 913-919.
3. Ye XT, Huang H, Huang WP, Hu WL (2018). LncRNA THOR promotes human renal cell carcinoma cell growth. Biochem Biophys Res Commun 501(3): 661-667.







