TOPORS-AS1

Species: Homo sapiens

Position: chr9: 32551772-32552913

Known as:

Transcript: ENST00000450093

Sequence: Download

Description:

We developed a CRISPR interference (CRISPRi) platform targeting 16,401 lncRNA loci in seven diverse cell lines, including six transformed cell lines and human induced pluripotent stem cells (iPSCs). We classified lncRNA genes as hits if their combined phenotype effect size and P value (referred to here as “screen score”) exceeded a consistent threshold applied to each screen corresponding to an empirical FDR of 5%. Large-scale screening identified 499 lncRNA loci required for robust cellular growth, of which 89% showed growth modifying function exclusively in one cell type.



sgRNAs

sgRNA_ID Sequence Position (Chr) Position (Lnc) Length PAM Type Validity Cell line Note Ref.
sgRNA1 AAACATTCTAGAGCTGAACC 32551672-32551691(+) up stream 20 TGG CRISPRi Partial validated iPSC NA [1]
sgRNA2 ACTAGAAAGAAAACCAGTGG 32552130-32552149(+) gene body (near 5') 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA3 TTTGTCACATATAAAAGAGT 32551898-32551917(+) gene body (near 5') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA4 GGGGCTTAGTATCTCACGCG 32551723-32551742(+) up stream 20 CGG CRISPRi Partial validated iPSC NA [1]
sgRNA5 CCCGAGCACGGCAGTTTGGT 32551706-32551725(-) up stream 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA6 GAGATACTAAGCCCCGAGCA 32551718-32551737(-) up stream 20 CGG CRISPRi Partial validated iPSC NA [1]
sgRNA7 AAGAATGGCTCGATTTACAG 32551863-32551882(+) gene body (near 5') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA8 GTTTGGTGGGCGAGCGTACC 32551693-32551712(-) up stream 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA9 ATCTCTAAGAAGAAATACGT 32551820-32551839(-) gene body (near 5') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA10 AAGCCCCGAGCACGGCAGTT 32551710-32551729(-) up stream 20 TGG CRISPRi Partial validated iPSC NA [1]

GBrowser


Links

lncRNA Function:

sgRNA Design Tool:

Reference

1. Liu SJ, Horlbeck MA, Cho SW, Birk HS, Malatesta M, et al. (2017). CRISPRi-based genome-scale identification of functional long noncoding RNA loci in human cells. Science 355(6320).