TP73-AS1
Species: Homo sapiens
Position: chr1: 3735983-3747373
Known as: TP73-AS1 , ENSG00000227372
Transcript: NR_033709 , NR_033710 , NR_033711 , NR_033708 , NR_033712 , ENST00000452079 , ENST00000418088 , ENST00000423764
Sequence: Download
Description:
TP73-AS1 is clinically relevant in GBM, as high expression is associated with poor patient outcome in three independent, nonoverlapping primary GBM patient cohorts. Furthermore, TP73-AS1 downregulation leads to loss of ALDH1A1 expression and re-sensitizes gCSC to TMZ treatment. TP73-AS1 comprises a clinically relevant lncRNA conferring TMZ resistance in gCSC, and may therefore serve as an important predictive biomarker and a therapeutic target in a currently fatal disease.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | GCAGTCGGGGCTGACGGCGG | 3747255-3747274(-) | gene body (near 5') | 20 | CGG | CRISPRi | Experimental validated | G7, G26 | NA | [1] |
| sgRNA2 | CCTAGATGGGAGCCGGGGAT | 3747296-3747315(-) | gene body (near 5') | 20 | GGG | CRISPRi | Experimental validated | G7, G26 | NA | [1] |
GBrowser
Links
Reference
1. Mazor G, Levin L, Picard D, Ahmadov U, Carén H, et al. (2019). The lncRNA TP73-AS1 is linked to aggressiveness in glioblastoma and promotes temozolomide resistance in glioblastoma cancer stem cells. Cell Death Dis 10(3): 246.
