Trdn-AS
Species: Mus musculus
Position: chr10: 33222344-33256418
Known as: D830005E20Rik , ENSMUSG00000112707
Transcript: NR_040657 , ENSMUST00000217716 , ENSMUST00000219691
Sequence: Download
Description:
TRDN-AS is localized in the antisense position of the gene encoding triadin (TRDN), and can regulate the balance between cardiac and skeletal isoforms of triadin. Expression of TRDN-AS and cardiac TRDN was up-regulated in biopsies from failing human hearts compared to control hearts. In failing hearts, TRDN-AS was positively correlated with a cardiac isoform of TRDN and negatively correlated with a skeletal muscle isoform of TRDN. A murine homolog of human TRDN-AS was identified and found to be enriched in the heart and localized in the nuclear compartment of cardiomyocytes. Trdn-AS expression as well as the ratio between cardiac and skeletal muscle isoforms were down-regulated after experimental myocardial infarction. In murine cardiomyocytes, activation of Trdn-AS transcription with the CRISPR/dCas9-VPR system enhanced the ratio between cardiac and skeletal isoforms of Trdn.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| Trda-AS_sgRNA | GTGACATTCATGTGGCAGTG | 33256424-33256443(-) | up stream | 20 | TGG | CRISPRa | Experimental validated | HL-1 | NA | [1] |
GBrowser
Links
Reference
1. Zhang L, Salgado-Somoza A, Vausort M, Leszek P, Devaux Y, et al. (2018). A heart-enriched antisense long non-coding RNA regulates the balance between cardiac and skeletal muscle triadin. Biochim Biophys Acta 1865(2): 247-258.







