Trincr1
Species: Mus musculus
Position: chr8: 87472811-87525554
Known as: Gm2694 , ENSMUSG00000097248
Transcript: NR_033430 , NR_125722 , ENSMUST00000180700 , ENSMUST00000180806 , ENSMUST00000181898 , ENSMUST00000181159
Sequence: Download
Description:
Trincr1 also named as Gm2694. Trincr1 is exported by THOC complex to cytoplasm where it binds and represses TRIM71, leading to the downregulation of SHCBP1 protein. Knocking out Trincr1 leads to the upregulation of phosphorylated ERK and ERK pathway target genes and the decrease of ESC selfrenewal, while knocking down Trim71 completely rescues the defects of Trincr1 knockout. Furthermore, ectopic expression of Trincr1 represses FGF/ERK signaling and the self-renewal of neural progenitor cells (NPCs).
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | GACATGCTTGGTAACTATGT | 87521730-87521749(-) | gene body (near 3') | 20 | AGG | CRISPRko | Experimental validated | ESCs | paried with sgRNA2 | [1] |
| sgRNA2 | GAAGCAGAACCCAGACCAAC | 87525575-87525594(-) | down stream | 20 | AGG | CRISPRko | Experimental validated | ESCs | paried with sgRNA1 | [1] |
GBrowser
Links
Reference
1. Li YP, Duan FF, Zhao YT, Gu KL, Liao LQ, et al. (2019). A TRIM71 binding long noncoding RNA Trincr1 represses FGF/ERK signaling in embryonic stem cells. Nat Commun 10(1): 1368.
