UCA1

Species: Homo sapiens

Position: chr19: 15828205-15836321

Known as: UCA1 , ENSG00000214049

Transcript: NR_015379 , ENST00000397381 , ENST00000645805 , ENST00000644400 , ENST00000642256

Sequence: Download

Description:

The lncRNA urothelial carcinoma-associated 1 (UCA1) is upregulated in bladder cancer and promotes the progression of bladder cancer. By designing gRNAs specific to UCA1 and constructing CRISPR/Cas9 systems targeting UCA1, single CRISPR/Cas9-UCA1 can effectively inhibit UCA1 expression when transfected into 5637 and T24 bladder cancer cells, while the combined transfection of the two most effective CRISPR/Cas9-UCA1s can generate more satisfied inhibitory effect. UCA1 knockdown results in the significant inhibition of cell proliferation, migration and invasion in vitro and in vivo. The mechanisms associated with the inhibitory effect of CRISPR/Cas9-UCA1 on malignant phenotypes of bladder cancer are attributed to the induction of cell cycle arrest at G1 phase, a substantial increase of apoptosis, and an enhanced activity of MMPs. Additionally, urinary UCA1 can be used as a non-invasive diagnostic marker for bladder cancer as revealed by a meta-analysis.



sgRNAs

sgRNA_ID Sequence Position (Chr) Position (Lnc) Length PAM Type Validity Cell line Note Ref.
sgRNA1 AACAAGGCTGTTAATTCACT 15829132-15829151(-) gene body (near 5') 20 TGG CRISPRi High activity 5637;T24 highly suppressed UCA1 [1] [2]
sgRNA2 AGGGGCAGCTTTATAGGGCT 15829060-15829079(-) gene body (near 5') 20 GGG CRISPRi High activity 5637;T24 highly suppressed UCA1 [1] [2]
sgRNA3 GGTTTCCTTTTAGATGACGG 15828455-15828474(+) gene body (near 5') 20 AGG CRISPRko Experimental validated HEK293T paried with sgRNA4 [3]
sgRNA4 TCTGAAAAGAGAGTCAGCGA 15829093-15829112(-) gene body (near 5') 20 AGG CRISPRko Experimental validated HEK293T paried with sgRNA3 [3]
sgRNA5 GTGCATGGTGGAGAGATGAT 15828973-15828992(-) gene body (near 5') 20 GGG CRISPRko Experimental validated HCT116 paried with sgRNA6 [4]
sgRNA6 TTCTGGAATGGTGAACCCAA 15834647-15834666(-) gene body (near 3') 20 TGG CRISPRko Experimental validated HCT116 paried with sgRNA5 [4]

GBrowser


Links

lncRNA Function:

sgRNA Design Tool:

Reference

1. Zhen S, Hua L, Liu YH, Sun XM, Jiang MM, et al. (2017). Inhibition of long non-coding RNA UCA1 by CRISPR/Cas9 attenuated malignant phenotypes of bladder cancer. Oncotarget 8(6): 9634-9646.

2. Zhen S, Lu J, Chen W, Zhao L, Li X (2018). Synergistic Antitumor Effect on Bladder Cancer by Rational Combination of Programmed Cell Death 1 Blockade and CRISPR-Cas9-Mediated Long Non-Coding RNA Urothelial Carcinoma Associated 1 Knockout. Hum Gene Ther 29(12): 1352-1363.

3. Aparicio-Prat E, Arnan C, Sala I, Bosch N, Guigó R, et al. (2015). DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics 16: 846.

4. Ho TT, Zhou N, Huang J, Koirala P, Xu M, et al. (2015). Targeting non-coding RNAs with the CRISPR/Cas9 system in human cell lines. Nucleic Acids Res 43(3): e17.