UCA1
Species: Homo sapiens
Position: chr19: 15828205-15836321
Known as: UCA1 , ENSG00000214049
Transcript: NR_015379 , ENST00000397381 , ENST00000645805 , ENST00000644400 , ENST00000642256
Sequence: Download
Description:
The lncRNA urothelial carcinoma-associated 1 (UCA1) is upregulated in bladder cancer and promotes the progression of bladder cancer. By designing gRNAs specific to UCA1 and constructing CRISPR/Cas9 systems targeting UCA1, single CRISPR/Cas9-UCA1 can effectively inhibit UCA1 expression when transfected into 5637 and T24 bladder cancer cells, while the combined transfection of the two most effective CRISPR/Cas9-UCA1s can generate more satisfied inhibitory effect. UCA1 knockdown results in the significant inhibition of cell proliferation, migration and invasion in vitro and in vivo. The mechanisms associated with the inhibitory effect of CRISPR/Cas9-UCA1 on malignant phenotypes of bladder cancer are attributed to the induction of cell cycle arrest at G1 phase, a substantial increase of apoptosis, and an enhanced activity of MMPs. Additionally, urinary UCA1 can be used as a non-invasive diagnostic marker for bladder cancer as revealed by a meta-analysis.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | AACAAGGCTGTTAATTCACT | 15829132-15829151(-) | gene body (near 5') | 20 | TGG | CRISPRi | High activity | 5637;T24 | highly suppressed UCA1 | [1] [2] |
| sgRNA2 | AGGGGCAGCTTTATAGGGCT | 15829060-15829079(-) | gene body (near 5') | 20 | GGG | CRISPRi | High activity | 5637;T24 | highly suppressed UCA1 | [1] [2] |
| sgRNA3 | GGTTTCCTTTTAGATGACGG | 15828455-15828474(+) | gene body (near 5') | 20 | AGG | CRISPRko | Experimental validated | HEK293T | paried with sgRNA4 | [3] |
| sgRNA4 | TCTGAAAAGAGAGTCAGCGA | 15829093-15829112(-) | gene body (near 5') | 20 | AGG | CRISPRko | Experimental validated | HEK293T | paried with sgRNA3 | [3] |
| sgRNA5 | GTGCATGGTGGAGAGATGAT | 15828973-15828992(-) | gene body (near 5') | 20 | GGG | CRISPRko | Experimental validated | HCT116 | paried with sgRNA6 | [4] |
| sgRNA6 | TTCTGGAATGGTGAACCCAA | 15834647-15834666(-) | gene body (near 3') | 20 | TGG | CRISPRko | Experimental validated | HCT116 | paried with sgRNA5 | [4] |
GBrowser
Links
Reference
1. Zhen S, Hua L, Liu YH, Sun XM, Jiang MM, et al. (2017). Inhibition of long non-coding RNA UCA1 by CRISPR/Cas9 attenuated malignant phenotypes of bladder cancer. Oncotarget 8(6): 9634-9646.
2. Zhen S, Lu J, Chen W, Zhao L, Li X (2018). Synergistic Antitumor Effect on Bladder Cancer by Rational Combination of Programmed Cell Death 1 Blockade and CRISPR-Cas9-Mediated Long Non-Coding RNA Urothelial Carcinoma Associated 1 Knockout. Hum Gene Ther 29(12): 1352-1363.
3. Aparicio-Prat E, Arnan C, Sala I, Bosch N, Guigó R, et al. (2015). DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics 16: 846.
4. Ho TT, Zhou N, Huang J, Koirala P, Xu M, et al. (2015). Targeting non-coding RNAs with the CRISPR/Cas9 system in human cell lines. Nucleic Acids Res 43(3): e17.