WAKMAR2
Species: Homo sapiens
Position: chr6: 137823668-137868233
Known as: WAKMAR2 , ENSG00000237499
Transcript: NR_049793
Sequence: Download
Description:
WAKMAR2, also named as LOC100130476, which play a potenital role in skin wound repair. LOC100130476 is an RNA polymerase IIeencoded polyadenylated transcript present in both cytoplasm and nucleus.It's expression was lower in wound-edge keratinocytes of human chronic wounds compared to normal wounds of healthy donors and intact skin. In cultured keratinocytes, LOC100130476 expression was induced by TGF-b signaling. By reducing LOC100130476 expression with antisense oligos or activating its transcription with CRISPR/Cas9 Synergistic Activation Mediator system, we showed that LOC100130476 restricted the production of inflammatory chemokines by keratinocytes, while enhancing cell migration. In line with this, knockdown of LOC100130476 impaired re-epithelization of human ex vivo wounds.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | GACAAAGACAGTCTAACCGT | 137868166-137868185(-) | gene body (near 5') | 20 | GGG | CRISPRa | Experimental validated | Human primary epidermal keratinocytes | NA | [1] |
| sgRNA2 | CCTGAGACACTTGACCAGAC | 137868323-137868342(-) | up stream | 20 | TGG | CRISPRa | Experimental validated | Human primary epidermal keratinocytes | NA | [1] |
GBrowser
Links
Reference
1. Herter EK, Li D, Toma MA, Vij M, Li X, et al. (2019). WAKMAR2, a Long Noncoding RNA Downregulated in Human Chronic Wounds, Modulates Keratinocyte Motility and Production of Inflammatory Chemokines. J Invest Dermatol 139(6): 1373-1384.







