XIST
Species: Homo sapiens
Position: chrX: 73820650-73852753
Known as: XIST , ENSG00000229807
Transcript: NR_001564 , ENST00000429829 , ENST00000434839 , ENST00000635841 , ENST00000602495 , ENST00000602863 , ENST00000416330
Sequence: Download
Description:
XIST is one of the long non-coding RNA, which is located in X-inactivation center (Xic) and is required for the X-inactivation. Human XIST encodes approximately 17 kb of transcripts, and several tandem repeats named A-F repeat are conserved among mammals. Although it has been revealed that the A-repeat contributes to the X chromosome inactivation (X-inactivation), the role of the longest D-repeat has not yet been investigated. Here, a sgRNA directed CRISPR/Cas9 system which have multiple target sites within repeat D of XIST, were used to generate D-repeat deletion and studied its roles on X-inactivation. The results showed that the deletion of D-repeat caused a significantly decreased expression of XIST, and upregulated expression of X-linked genes, suggesting that the D-repeat may play an important role in the regulation of XIST expression and silencing of the X-linked genes, which could provide a new idea in the molecular mechanisms of X-inactivation.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | TGCAAAAGGGGTCTGAGAGT | 73844758-73844777(+) | gene body (near 5') | 20 | AGG | CRISPRko | High activity | HEK293FT;Hela | obscure bands and no PCR product of 2537 bp was detected | [1] |
| sgRNA2 | GCAGCGCTTTAAGAACTGAA | 73852732-73852751(+) | gene body (near 5') | 20 | GGG | CRISPRi | High activity | K562;231BrM | yielded >85% knockdown | [2] [3] |
| sgRNA3 | GACTGAAGATCTCTCTGCACTT | 73852659-73852680(-) | gene body (near 5') | 22 | GGG | CRISPRi | High activity | K562 | yielded >85% knockdown | [2] |
| sgRNA4 | GCCATATTTCTTACTCTCTCG | 73852697-73852717(-) | gene body (near 5') | 21 | GGG | CRISPRi | High activity | K562 | yielded >85% knockdown | [2] |
| sgRNA5 | TGTCCGGCTTTCAATCTTCT | 73852792-73852811(-) | up stream | 20 | AGG | CRISPRi | Experimental validated | 231BrM | NA | [3] |
GBrowser
Links
Reference
1. Lv Q, Yuan L, Song Y, Sui T, Li Z, et al. (2016). D-repeat in the XIST gene is required for X chromosome inactivation. RNA Biol 13(2): 172-6.
2. Gilbert LA, Horlbeck MA, Adamson B, Villalta JE, Chen Y, et al. (2014). Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation. Cell 159(3): 647-61.
3. Xing F, Liu Y, Wu SY, Wu K, Sharma S, et al. (2018). Loss of XIST in Breast Cancer Activates MSN-c-Met and Reprograms Microglia via Exosomal miRNA to Promote Brain Metastasis. Cancer Res 78(15): 4316-4330.