XIST
Species: Sus scrofa
Position: chrX: 59277352-59310014
Known as: LOC102165344
Transcript: KC753465
Sequence: Download
Description:
Among many factors which affect the efficiency of cloning pigs, X chromosome inactivation is an important one. Moreover, XIST gene is closely related to X chromosome inactivation, suggesting that it may directly or indirectly affects cloning efficiency. In this study, multiple sgRNAs were designed based on the CRISPR/Cas9 system, and two sites (Target 3 and Target 4) whose mutation efficiency were 1% and 3% at the cellular level were selected. We successfully knocked out XIST with 100% efficiency by microinjecting sgRNAs for Target 3 and Target 4 in embryo. Finally, 6 cloning piglets were born including two XIST-fully-knockout piglets. The follow-up studies on increasing cloning efficiency can be carried out based on the XIST-knockout model.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | GGATCCCATCCCTCCTAC | 59305024-59305041(-) | gene body (near 5') | 18 | TGG | CRISPRko | Experimental validated | embryo | NA | [1] |
| sgRNA2 | GAATGTTTTTTGGTTGACTCTTC | 59309740-59309762(-) | gene body (near 5') | 23 | TGG | CRISPRko | Experimental validated | embryo | NA | [1] |
| sgRNA3 | GGCTATTATTCATCTTAACC | 59293049-59293068(+) | gene body (near 3') | 20 | AGG | CRISPRko | High activity | embryo | Mutation rate 75% | [1] |
| sgRNA4 | GGTATAGCCAAAACAGGAA | 59293401-59293419(+) | gene body (near 3') | 19 | TGG | CRISPRko | High activity | embryo | Mutation rate 85.7% | [1] |
| sgRNA5 | GGAAAAGTGTTGGGTTTTG | 59309257-59309275(-) | gene body (near 5') | 19 | TGG | CRISPRko | Experimental validated | embryo | NA | [1] |
GBrowser
Links
Reference
1. Li GL, Zhong CL, Ni S, Liu DW, Cai GY, et al. (2016). Establishment of porcine Xist knockout model using CRISPR/Cas9 system. Yi Chuan 38(12): 1081-1089.
