Xist
Species: Mus musculus
Position: chrX: 103460372-103483233
Known as: Xist , ENSMUSG00000086503
Transcript: NR_001570 , NR_001463 , ENSMUST00000127786
Sequence: Download
Description:
Xist encodes a long noncoding RNA which is a central player to induce X-chromosome inactivation in female mammals and has two major splicing variants: long and short isoforms of Xist RNA. Using CRISPR/Cas9-mediated targeted modification of the 5' splice site in Xist intron 7 to mediate alternative splicing, it was found that both long and short Xist isoforms can induce X-chromosome inactivation normally during ES cell differentiation, suggesting that the short splicing isoform of Xist RNA is sufficient to induce X-chromosome inactivation.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | CATACGTAGTTCCCCGCTCT | 103466374-103466393(+) | gene body (near 3') | 20 | TGG | CRISPRedit | Experimental validated | ESCs | NA | [1] |
GBrowser
Links
Reference
1. Yue M, Ogawa Y (2018). CRISPR/Cas9-mediated modulation of splicing efficiency reveals short splicing isoform of Xist RNA is sufficient to induce X-chromosome inactivation. Nucleic Acids Res 46(5): e26.
