YIYA
Species: Homo sapiens
Position: chr1: 213924748-213926654
Known as: LINC00538 , ENSG00000281664
Transcript: NR_046189 , ENST00000626109
Sequence: Download
Description:
lncRNA LINC00538 (YIYA) promotes glycolysis, cell proliferation and tumor growth in in breast cancer. YIYA associated with the cytosolic cyclin-dependent kinase CDK6 and regulated CDK6-dependent phosphorylation of the fructose bisphosphatase PFK2 (PFKFB3) in a cell cycle-independent manner. In breast cancer cells, these events promoted catalysis of glucose 6-phosphate to fructose-2,6-bisphosphate/fructose-1,6-bisphosphate. CRISPR/Cas9-mediated deletion of YIYA or CDK6 silencing impaired glycolysis and tumor growth in vivo. In clinical specimens of breast cancer, YIYA was expressed in ~40% of cases where it correlated with CDK6 expression and unfavorable survival outcomes.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | GGAATCTAGATGAGAAGTGA | 213924751-213924770(-) | gene body (near 5') | 20 | TGG | CRISPRko | Experimental validated | MDA-MB-231 | NA | [1] |
| sgRNA2 | GTGAGGGAGAAGTGCTTCAG | 213926620-213926639(-) | gene body (near 3') | 20 | AGG | CRISPRko | Experimental validated | MDA-MB-231 | NA | [1] |
GBrowser
Links
Reference
1. Xing Z, Zhang Y, Liang K, Yan L, Xiang Y, et al. (2018). Expression of Long Noncoding RNA YIYA Promotes Glycolysis in Breast Cancer. Cancer Res 78(16): 4524-4532.







