linc-206
Species: Caenorhabditis elegans
Position: chr1: 5838121-5839198
Known as:
Transcript: linc-206_1 , linc-206_2
Sequence: Download
Description:
Using CRISPR/Cas9 genome editing, we generated deletion mutants for ten long non-coding RNA loci. Using automated microscopy for in-depth phenotyping, we show that six of the long non-coding RNA loci are required for normal development and fertility. Using RNA interference-mediated gene knock-down, we provide evidence that for two of the long non-coding RNA loci, the observed phenotypes are dependent on the corresponding RNA transcripts.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | CTCGGGATTACGGTAGTTGG | 5838645-5838664(+) | gene body (near 5') | 20 | AGG | CRISPRko | Experimental validated | gonad | NA | [1] |
| sgRNA2 | TTCTCATTTTGAAATACCGG | 5838710-5838729(-) | gene body (near 3') | 20 | AGG | CRISPRko | Experimental validated | gonad | NA | [1] |
| sgRNA3 | ATGAGGTACACACGTGATGG | 5839118-5839137(-) | gene body (near 3') | 20 | TGG | CRISPRko | Experimental validated | gonad | NA | [1] |
GBrowser
Links
Reference
1. Akay A, Jordan D, Navarro IC, Wrzesinski T, Ponting CP, et al. (2019). Identification of functional long non-coding RNAs in C. elegans. BMC Biol 17(1): 14.
