linc-217
Species: Caenorhabditis elegans
Position: chr1: 10864982-10866494
Known as:
Transcript: linc-217
Sequence: Download
Description:
Using CRISPR/Cas9 genome editing, we generated deletion mutants for ten long non-coding RNA loci. Using automated microscopy for in-depth phenotyping, we show that six of the long non-coding RNA loci are required for normal development and fertility. Using RNA interference-mediated gene knock-down, we provide evidence that for two of the long non-coding RNA loci, the observed phenotypes are dependent on the corresponding RNA transcripts.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | AAGAAGAGAAGAAACACGGG | 10866698-10866717(+) | up stream | 20 | AGG | CRISPRko | Experimental validated | gonad | NA | [1] |
GBrowser
Links
Reference
1. Akay A, Jordan D, Navarro IC, Wrzesinski T, Ponting CP, et al. (2019). Identification of functional long non-coding RNAs in C. elegans. BMC Biol 17(1): 14.







