linc-249
Species: Caenorhabditis elegans
Position: chr2: 10373375-10374822
Known as:
Transcript: linc-249_1 , linc-249_2
Sequence: Download
Description:
Using CRISPR/Cas9 genome editing, we generated deletion mutants for ten long non-coding RNA loci. Using automated microscopy for in-depth phenotyping, we show that six of the long non-coding RNA loci are required for normal development and fertility. Using RNA interference-mediated gene knock-down, we provide evidence that for two of the long non-coding RNA loci, the observed phenotypes are dependent on the corresponding RNA transcripts.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | GAGGCCATCTGCCCGATAAT | 10373630-10373649(+) | gene body (near 5') | 20 | TGG | CRISPRko | Experimental validated | gonad | NA | [1] |
| sgRNA2 | GGCACCAATGGCTACTTACG | 10374959-10374978(+) | down stream | 20 | TGG | CRISPRko | Experimental validated | gonad | NA | [1] |
| sgRNA3 | AATTTCGAGAAATGCTTCCC | 10372729-10372748(+) | up stream | 20 | CGG | CRISPRko | Experimental validated | gonad | NA | [1] |
| sgRNA4 | AATTCCACGTAAGTAGCCAT | 10374966-10374985(-) | down stream | 20 | TGG | CRISPRko | Experimental validated | gonad | NA | [1] |
GBrowser
Links
Reference
1. Akay A, Jordan D, Navarro IC, Wrzesinski T, Ponting CP, et al. (2019). Identification of functional long non-coding RNAs in C. elegans. BMC Biol 17(1): 14.
