linc-340
Species: Caenorhabditis elegans
Position: chrX: 16824029-16827916
Known as:
Transcript: linc-340_1 , linc-340_2 , linc-340_3 , linc-340_4 , linc-340_5 , linc-340_6 , linc-340_7 , linc-340_8
Sequence: Download
Description:
Using CRISPR/Cas9 genome editing, we generated deletion mutants for ten long non-coding RNA loci. Using automated microscopy for in-depth phenotyping, we show that six of the long non-coding RNA loci are required for normal development and fertility. Using RNA interference-mediated gene knock-down, we provide evidence that for two of the long non-coding RNA loci, the observed phenotypes are dependent on the corresponding RNA transcripts.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | ATTTCAATATACTAGCCCAG | 16823941-16823960(+) | up stream | 20 | AGG | CRISPRko | Experimental validated | gonad | NA | [1] |
GBrowser
Links
Reference
1. Akay A, Jordan D, Navarro IC, Wrzesinski T, Ponting CP, et al. (2019). Identification of functional long non-coding RNAs in C. elegans. BMC Biol 17(1): 14.
