lncCSR
Species: Mus musculus
Position: chr12: 110590511-110591582
Known as:
Transcript: AK020436
Sequence: Download
Description:
A distal divergent eRNA-expressing element (lncCSR) is engaged in long-range DNA interactions and regulating IgH 3' regulatory region super-enhancer function. CRISPR-Cas9 mediated ablation of lncCSR transcription decreases its chromosomal looping-mediated association with the IgH 3' regulatory region super-enhancer and leads to decreased class switch recombination efficiency. We propose that the RNA exosome protects divergently transcribed lncRNA expressing enhancers, by resolving deleterious transcription-coupled secondary DNA structures, while also regulating long-range super-enhancer chromosomal interactions important for cellular function.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | AGGCAGGTGAGGATAATTCC | 110590432-110590451(-) | down stream | 20 | TGG | CRISPRko | Experimental validated | CH12F3 | paried with sgRNA2 | [1] |
| sgRNA2 | CGGACCCAAGCTTAGACGCT | 110591518-110591537(+) | gene body (near 5') | 20 | TGG | CRISPRko | Experimental validated | CH12F3 | paried with sgRNA1 | [1] |
GBrowser
Links
Reference
1. Pefanis E, Wang J, Rothschild G, Lim J, Kazadi D, et al. (2015). RNA exosome-regulated long non-coding RNA transcription controls super-enhancer activity. Cell 161(4): 774-89.
