lncRNA-IFI6
Species: Homo sapiens
Position: chr1: 27669467-27670276
Known as: ENSG00000225886
Transcript: ENST00000430683
Sequence: Download
Description:
LncRNA-IFI6 located within the IFI6 gene, as a negative regulator of IFI6. We found that lncRNA IFI6 plays a critical role in the containment of HCV through regulation of histone modification of the IFI6 promoter.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | GTGCGGATTCGCACGGTGTT | 27669558-27669577(+) | gene body (near 5') | 20 | TGG | CRISPRko | Experimental validated | Huh7.5.1;PHHs | NA | [1] |
| sgRNA2 | GGATTCTGTGCGGATTCGCA | 27669551-27669570(+) | gene body (near 5') | 20 | CGG | CRISPRko | Experimental validated | Huh7.5.1;PHHs | NA | [1] |
| sgRNA3 | CAGAAGCCTCTCGTACGGTG | 27669953-27669972(-) | gene body (near 3') | 20 | AGG | CRISPRko | Experimental validated | Huh7.5.1;PHHs | NA | [1] |
GBrowser
Links
Reference
1. Liu X, Duan X, Holmes JA, Li W, Lee SH, et al. (2019). A Long Noncoding RNA Regulates Hepatitis C Virus Infection Through Interferon Alpha-Inducible Protein 6. Hepatology 69(3): 1004-1019.
