lncRNA1459
Species: Solanum lycopersicum
Position: chr3: 59012087-59013156
Known as:
Transcript: KT963310 , KT963311
Sequence: Download
Description:
LncRNA1459, a tomato ripening-related lncRNA, has two transcript isoforms with a specific location in the nucleus. Loss-of-function of LncRNA1459 significantly repressed the tomato ripening process, as well as ethylene production and lycopene accumulation. Additionally, genes related to ethylene and carotenoid biosynthesis were distinctly downregulated, and expression of numerous ripening-related genes was changed significantly when lncRNA1459 was knocked out. Expression of potential tomato ripening-related lncRNAs was also specifically changed after knocking out lncRNA1459.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA | GCCTTGCAACTCCTGTCGAA | 59013059-59013078(-) | gene body (near 3') | 20 | TGG | CRISPRko | Experimental validated | explants | NA | [1] |
GBrowser
Links
Reference
1. Li R, Fu D, Zhu B, Luo Y, Zhu H (2018). CRISPR/Cas9-mediated mutagenesis of lncRNA1459 alters tomato fruit ripening. Plant J 94(3): 513-524.
