lncRNA_TS17

Species: Drosophila melanogaster

Position: chr2R: 15048745-15049145

Known as:

Transcript: lncRNA_TS17

Sequence: Download

Description:

We identified 128 testis-specific Drosophila lncRNAs and knocked out 105 of them using an optimized three-component CRISPR/Cas9 system. Among the lncRNA knockouts, 33 (31%) exhibited a partial or complete loss of male fertility, accompanied by visual developmental defects in late spermatogenesis. In addition, six knockouts were fully or partially rescued by transgenes in a trans configuration, indicating that those lncRNAs primarily work in trans. Furthermore, gene expression profiles for five lncRNA mutants revealed that testis-specific lncRNAs regulate global gene expression, orchestrating late male germ cell differentiation.



sgRNAs

sgRNA_ID Sequence Position (Chr) Position (Lnc) Length PAM Type Validity Cell line Note Ref.
gRNA1 GGAAAGCCTTAACCATCGCA 15048688-15048707(+) up stream 20 AGG CRISPRko Homologous recombination efficiency: 16.13% embryo Knockout phenotype: male fertility decreased by 30%-60% [1]
gRNA2 GGATAACTCTCGAGTGAAAC 15049404-15049423(+) down stream 20 TGG CRISPRko Homologous recombination efficiency: 16.13% embryo Knockout phenotype: male fertility decreased by 30%-60% [1]

GBrowser


Links

lncRNA Function:

sgRNA Design Tool:

Reference

1. Wen K, Yang L, Xiong T, Di C, Ma D, et al. (2016). Critical roles of long noncoding RNAs in Drosophila spermatogenesis. Genome Res 26(9): 1233-44.