lncRNA_TS4
Species: Drosophila melanogaster
Position: chr2L: 2639300-2639600
Known as:
Transcript: lncRNA_TS4
Sequence: Download
Description:
We identified 128 testis-specific Drosophila lncRNAs and knocked out 105 of them using an optimized three-component CRISPR/Cas9 system. Among the lncRNA knockouts, 33 (31%) exhibited a partial or complete loss of male fertility, accompanied by visual developmental defects in late spermatogenesis. In addition, six knockouts were fully or partially rescued by transgenes in a trans configuration, indicating that those lncRNAs primarily work in trans. Furthermore, gene expression profiles for five lncRNA mutants revealed that testis-specific lncRNAs regulate global gene expression, orchestrating late male germ cell differentiation.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| gRNA1 | GGAGAATAAACTTTTCCAGC | 2639194-2639213(-) | up stream | 20 | AGG | CRISPRko | Homologous recombination efficiency: 8.33% | embryo | Knockout phenotype: no/minor phenotype | [1] |
| gRNA2 | GGACGCAGGACGATGGAGTC | 2639479-2639498(+) | gene body (near 3') | 20 | AGG | CRISPRko | Homologous recombination efficiency: 8.33% | embryo | Knockout phenotype: no/minor phenotype | [1] |
GBrowser
Links
Reference
1. Wen K, Yang L, Xiong T, Di C, Ma D, et al. (2016). Critical roles of long noncoding RNAs in Drosophila spermatogenesis. Genome Res 26(9): 1233-44.







