lncRNA_TS7
Species: Drosophila melanogaster
Position: chr3L: 3619700-3620150
Known as:
Transcript: lncRNA_TS7
Sequence: Download
Description:
We identified 128 testis-specific Drosophila lncRNAs and knocked out 105 of them using an optimized three-component CRISPR/Cas9 system. Among the lncRNA knockouts, 33 (31%) exhibited a partial or complete loss of male fertility, accompanied by visual developmental defects in late spermatogenesis. In addition, six knockouts were fully or partially rescued by transgenes in a trans configuration, indicating that those lncRNAs primarily work in trans. Furthermore, gene expression profiles for five lncRNA mutants revealed that testis-specific lncRNAs regulate global gene expression, orchestrating late male germ cell differentiation.
sgRNAs
sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
---|---|---|---|---|---|---|---|---|---|---|
gRNA1 | GGAATACCTTATGACGTCTGA | 3619782-3619802(-) | gene body (near 5') | 21 | AGG | CRISPRko | Homologous recombination efficiency: 14.55% | embryo | Knockout phenotype: no/minor phenotype | [1] |
gRNA2 | GGGAGAAATGGAGAAGTGT | 3619925-3619943(-) | gene body (near 3') | 19 | CGG | CRISPRko | Homologous recombination efficiency: 14.55% | embryo | Knockout phenotype: no/minor phenotype | [1] |
GBrowser
Links
Reference
1. Wen K, Yang L, Xiong T, Di C, Ma D, et al. (2016). Critical roles of long noncoding RNAs in Drosophila spermatogenesis. Genome Res 26(9): 1233-44.