roX1
Species: Drosophila melanogaster
Position: chrX: 3857229-3862697
Known as: roX1 , FBgn0019661
Transcript: NR_073631 , NR_002098 , NR_002097 , NR_123784 , NR_073632 , FBtr0345714 , FBtr0337066 , FBtr0337067 , FBtr0070634 , FBtr0070635
Sequence: Download
Description:
RNA on X chromosome gene (roX) encodes the lncRNAs involved in dosage compensation in Drosophila males. The male-specific roX RNAs, roX1 and roX2, form complex with the MSL (male-specific lethal) proteins and facilitate targeting of the complex on the X chromosome, necessary for 2-fold hyperactivation of the X-linked genes in males. Genetic analysis shows that roX1 roX2 double mutants are male lethal which is rescued by either roX1 or roX2 cDNA, suggesting functional redundancy in their activity. For roX1 gene, although ineffective individually, combinations of sgRNAs targeting the template strand (rT1+rT3) or both the template and non-template strand (rT4+rNT5) show striking loss in roX1 RNA levels (50% and 90%, respectively). Additionally, the Drosophila codon-optimized dCas9 has better silencing performance than human dCas9 (97% reduction for Drosophila dCas9 versus 50% for human dCas9 of roX1 RA and RB RNA with sgRNAs that target the 5' region of roX1 RA TSS (rT1+rT3).
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | ATACAATAATATTAGCTAAC | 3862873-3862892(-) | up stream | 20 | TGG | CRISPRi | High activity | CME-W1-Cl.8+ | striking reduction (97% for Drosophila dCas9 versus 50% for human dCas9) | [1] |
| sgRNA2 | TAACATTAACAGCAATGTTT | 3862800-3862819(+) | up stream | 20 | GGG | CRISPRi | Experimental validated | CME-W1-Cl.8+ | NA | [1] |
| sgRNA3 | CTCGTTGGAAAAAGTTACTG | 3862727-3862746(-) | up stream | 20 | TGG | CRISPRi | High activity | CME-W1-Cl.8+ | striking reduction (97% for Drosophila dCas9 versus 50% for human dCas9) | [1] |
| sgRNA4 | TAGAACAATTACGTTCGGAG | 3862675-3862694(-) | gene body (near 5') | 20 | TGG | CRISPRi | Experimental validated | CME-W1-Cl.8+ | NA | [1] |
| sgRNA5 | TACTATTACCGATCGATCAC | 3862626-3862645(+) | gene body (near 5') | 20 | TGG | CRISPRi | Experimental validated | CME-W1-Cl.8+ | NA | [1] |
| sgRNA6 | TGTTAATTTGCCTTACCAAC | 3862583-3862602(+) | gene body (near 5') | 20 | TGG | CRISPRi | High activity | CME-W1-Cl.8+ | robust reduction of roX1 transcript | [1] |
| sgRNA7 | CGAAAAAACGAGGGCCATTA | 3862437-3862456(+) | gene body (near 5') | 20 | GGG | CRISPRi | High activity | CME-W1-Cl.8+ | robust reduction of roX1 transcript | [1] |
| sgRNA8 | AAGAAAAGTGTTAGTTACC | 3862390-3862408(-) | gene body (near 5') | 19 | AGG | CRISPRi | High activity | CME-W1-Cl.8+ | robust reduction of roX1 transcript | [1] |
| sgRNA9 | TCGACAAGTGGCAGCCCTAA | 3862454-3862473(-) | gene body (near 5') | 20 | TGG | CRISPRi | High activity | CME-W1-Cl.8+ | robust reduction of roX1 transcript | [1] |
GBrowser
Links
Reference
1. Ghosh S, Tibbit C, Liu JL (2016). Effective knockdown of Drosophila long non-coding RNAs by CRISPR interference. Nucleic Acids Res 44(9): e84.
