roX2
Species: Drosophila melanogaster
Position: chrX: 11579064-11580432
Known as: roX2 , FBgn0019660
Transcript: NR_002104 , NR_002105 , NR_047796 , NR_047795 , NR_123871 , NR_123872 , FBtr0073515 , FBtr0308845 , FBtr0343986 , FBtr0343985 , FBtr0073514 , FBtr0308846
Sequence: Download
Description:
Using Drosophila dCas9, the combined sgRNA strategy was tested on the efficiency of abrogating roX2 transcription. Three targeting sequences around the roX2 RNA TSS, complementary to both the non-template (rNTa) and template (rTb and rTc) strands are choose. Coexpression of the sgRNAs with human dCas9 did not affect the roX2 transcript level signifcantly. However, when the same combinations of sgRNAs were expressed together with the Drosophila dCas9, roX2 transcript was significantly reducted (90% knockdown) in the sgRNAs flanking the transcription start site (rTb+rTc). Importantly, the roX1 transcript was unaffected in the same cell line, demonstrating the specifcity of the knockdown.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | CTGCATGAATCCGAAAATAG | 11578901-11578920(-) | up stream | 20 | CGG | CRISPRi | Experimental validated | CME-W1-Cl.8+ | NA | [1] |
| sgRNA2 | CCAAAACTCGAAAATATCAA | 11579019-11579038(+) | up stream | 20 | GGG | CRISPRi | High activity | CME-W1-Cl.8+ | 90% knockdown | [1] |
| sgRNA3 | GGCCTGGTCACACTAAGCTA | 11579071-11579090(+) | gene body (near 5') | 20 | GGG | CRISPRi | High activity | CME-W1-Cl.8+ | 90% knockdown | [1] |
GBrowser
Links
Reference
1. Ghosh S, Tibbit C, Liu JL (2016). Effective knockdown of Drosophila long non-coding RNAs by CRISPR interference. Nucleic Acids Res 44(9): e84.
