thor
Species: Danio rerio
Position: chr1: 7835709-7837877
Known as:
Transcript: thor
Sequence: Download
Description:
THOR is an ultra-conserved lncRNA, and presented an evolutionarily conserved function with a testis-specific tissue expression pattern across many species (like humans, mouse and zebrafish). THOR binds to IGF2BP1 and regulates broad target mRNA stabilization. Two sgRNAs targeting the conserved region of thor generated a population of homozygous thor-knockout zebrafish (thor-/-) in F2 generation, resulting in zebrafish fertilization defect and resistance to melanoma formation. Interestingly, the human THOR is capable of utilizing zebrafish cellular machinery to also produce a striking cancer phenotype. This trans-species function of THOR suggested that its sequence and function have both been evolutionarily selected for.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | CGATTGCACTGGTTGAGAAA | 7835831-7835850(-) | gene body (near 5') | 20 | AGG | CRISPRko | Experimental validated | embryo | paried with sgRNA2 | [1] |
| sgRNA2 | GGTCACCTTTTTGGTCGTGA | 7836798-7836817(+) | gene body (near 3') | 20 | TGG | CRISPRko | Experimental validated | embryo | paried with sgRNA1 | [1] |
GBrowser
Links
Reference
1. Hosono Y, Niknafs YS, Prensner JR, Iyer MK, Dhanasekaran SM, et al. (2017). Oncogenic Role of THOR, a Conserved Cancer/Testis Long Non-coding RNA. Cell 171(7): 1559-1572.e20.
