LncRNA Gene

ZFLNCG00174

Basic Information

Chromesome: chr1

Start: 13370488

End: 13370748

Transcript: ZFLNCT00257

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
ERR145635 skeletal muscle 27 degree_C to 16 degree_C 50.67
ERR145631 skeletal muscle 32 degree_C to 16 degree_C 44.17
ERR145646 skeletal muscle 32 degree_C to 27 degree_C 40.72
ERR023145 heart normal 31.91
SRR1562531 muscle normal 20.28
ERR145648 skeletal muscle 27 degree_C to 27 degree_C 19.98
SRR891510 muscle normal 18.83
SRR372802 5 dpf normal 14.57
SRR1342219 embryo marco morpholino and infection with Mycobacterium marinum 14.42
ERR023146 head kidney normal 13.30
Express in tissues
Correlated coding gene Download
gene correlation coefficent
LOC553326 0.68
LOC100333825 0.66
rapsn 0.64
dmd 0.62
adssl1 0.62
si:ch211-225p5.8 0.62
LOC573741 0.62
synpo2la 0.61
clic5a 0.61
abrab 0.61
Gene Ontology Download
GO P value
GO:0014706 5.00e-10
GO:0060537 5.94e-10
GO:0007519 6.42e-08
GO:0031032 5.16e-07
GO:0045214 1.31e-06
GO:0048738 2.96e-06
GO:0030036 1.47e-05
GO:0030029 1.82e-05
GO:0055001 5.04e-05
GO:0007010 6.91e-05
GO:0044853 4.42e-05
GO:0005901 4.42e-05
GO:0042383 6.28e-05
GO:0034702 8.11e-05
GO:1902495 1.50e-04
GO:1990351 1.64e-04
GO:0098797 2.16e-04
GO:0098590 3.30e-04
GO:0031463 3.51e-04
GO:0098857 4.07e-04
GO:0003779 3.61e-05
GO:0005261 3.75e-05
GO:0015267 5.61e-05
GO:0022803 5.61e-05
GO:0005216 9.96e-05
GO:0022836 1.12e-04
GO:0022838 1.49e-04
GO:0008092 3.44e-04
GO:0005219 6.63e-04
GO:0003676 1.08e-03
KEGG Pathway Download
KO P value
ko05412 5.52e-07
ko04921 5.56e-07
ko04260 2.41e-06
ko04020 3.58e-05
ko05410 3.67e-05
ko04261 3.85e-05
ko04022 3.90e-04
ko05414 6.84e-04
ko04371 8.36e-04
ko04010 8.42e-04
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG00174
CAAACACTGACAATTACTTTCCTGAATGTAGTTTACAGACTTAACTTACATTTAATACTTTTACACAGAC
TTTTATGACTTGTGTAAGTATTTTATTTTATCAGTCAGTTCATTCAGTGGTGGAGTCTGTCTGATTTAAT
TGTGTAGCACTTTTGATATTTTTTCCTCCCCAAGCGTGCAATATTATTATTTGAGAACAAATCTCTTTGG
AATTTTATATCTATGTATACAGTCAAGCCTGCAATTATACATACCCTGTA