LncRNA Gene

ZFLNCG00411

Basic Information

Chromesome: chr1

Start: 37222679

End: 37222961

Transcript: ZFLNCT00606

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR1647683 spleen SVCV treatment 40.88
SRR700534 heart control morpholino 37.04
SRR1647684 spleen SVCV treatment 36.37
SRR1291417 5 dpi injected marinum 24.26
SRR1299125 caudal fin Half day time after treatment 16.19
SRR1299129 caudal fin Seven days time after treatment 15.76
SRR700537 heart Gata4 morpholino 15.30
SRR527834 head normal 14.19
SRR1205157 5dpf transgenic sqET20 and neomycin treated 1h and GFP+ 14.19
SRR1562529 intestine and pancreas normal 13.51
Express in tissues
Correlated coding gene Download
gene correlation coefficent
stx2a 0.58
si:dkey-52l18.4 0.56
morc3a 0.56
si:ch211-165d12.4 0.56
pik3cb 0.56
fes 0.56
crfb2 0.56
si:ch211-149p10.2 0.55
tnfrsf1a 0.55
arpc4l 0.55
Gene Ontology Download
GO P value
GO:0006952 2.02e-06
GO:0051707 5.98e-06
GO:0051704 7.83e-06
GO:1901533 1.80e-05
GO:0043207 1.81e-05
GO:0009607 2.09e-05
GO:0045087 3.44e-05
GO:1903707 5.98e-05
GO:0042742 1.03e-04
GO:1901532 1.67e-04
GO:0019898 1.02e-03
GO:0043020 2.49e-03
GO:0031234 3.02e-03
GO:0019897 3.40e-03
GO:0005634 6.85e-03
GO:0043227 1.42e-02
GO:0072557 1.48e-02
GO:0097169 1.48e-02
GO:0072559 1.48e-02
GO:0061702 1.48e-02
GO:0003847 2.49e-03
GO:0004715 3.79e-03
GO:0004896 3.99e-03
GO:0032090 4.97e-03
GO:0005094 4.97e-03
GO:0004904 4.97e-03
GO:0046934 4.97e-03
GO:0052813 7.44e-03
GO:0050700 7.44e-03
GO:0019904 1.24e-02
KEGG Pathway Download
KO P value
ko04621 2.62e-09
ko05164 1.26e-07
ko05167 3.17e-07
ko05160 1.79e-06
ko04620 4.64e-06
ko04380 1.95e-05
ko05131 5.30e-05
ko05161 6.66e-05
ko04662 7.00e-05
ko05152 9.65e-05
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG00411
CTCTCAACATCTTAAAGTCTTCCTTTGGCATCACTGTTATTCCTCAATTTTGTTTTTCGATAAATTCTTT
TAAATTTCTGCAGAAGTGTTCAAACGTGCTGTAGTAGAAGGCCATTTTGTCAGACGCAGCATCTGAGATG
TGAACATTTGATGTCTCAGTTTACCAGGATGTAGGGAACTTCCTCTCTTACTTAAAACTAGAATGTTTTC
AACTACAGAGGGGGGATCAAATGGCAAGTACCTCACAGTCAAAAAGGTGCCTTAATGTCTGAGAAAGTAA
TA