LncRNA Gene

ZFLNCG00496

Basic Information

Chromesome: chr1

Start: 45605545

End: 45605785

Transcript: ZFLNCT00716

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR516124 skin male and 3.5 year 275.28
SRR1299126 caudal fin One day time after treatment 205.39
SRR372802 5 dpf normal 175.37
SRR516125 skin male and 3.5 year 161.36
SRR516123 skin male and 3.5 year 152.13
SRR592702 pineal gland normal 148.37
SRR1534351 larvae 500 ug/l BDE47 treatment 119.24
SRR1534350 larvae 5 ug/l BDE47 treatment 118.05
SRR941753 posterior pectoral fin normal 108.23
SRR941749 anterior pectoral fin normal 105.26
Express in tissues
Correlated coding gene Download
gene correlation coefficent
LOC568975 0.67
plekhs1 0.66
arid5b 0.66
wu:fk35f04 0.66
LOC100331329 0.65
LOC101882832 0.65
LOC100006655 0.64
LOC100333286 0.64
LOC100333218 0.64
si:rp71-1i20.2 0.64
Gene Ontology Download
GO P value
GO:0046483 7.01e-07
GO:0009987 9.18e-07
GO:0006139 1.84e-06
GO:0044237 1.96e-06
GO:1901360 6.05e-06
GO:0034641 9.47e-06
GO:0008152 1.49e-05
GO:0006725 1.50e-05
GO:0090304 1.82e-05
GO:0006807 1.82e-05
GO:0005911 1.53e-06
GO:0044424 1.05e-05
GO:0005737 8.41e-05
GO:0005922 1.19e-04
GO:0016020 1.56e-04
GO:0030054 2.00e-04
GO:0016021 2.04e-04
GO:0005886 2.33e-04
GO:0005921 2.36e-04
GO:0031224 3.05e-04
GO:0005488 1.23e-03
GO:0003674 1.98e-03
GO:0003824 2.76e-03
GO:0003676 3.83e-03
GO:0043169 6.92e-03
GO:0004974 8.03e-03
GO:0008116 8.03e-03
GO:0004667 8.03e-03
GO:0001631 8.03e-03
GO:0005515 8.12e-03
KEGG Pathway Download
KO P value
ko04060 4.20e-06
ko04514 4.21e-03
ko04512 7.54e-03
ko04974 1.28e-02
ko05145 2.63e-02
ko04530 2.85e-02
ko00590 2.90e-02
ko04712 3.54e-02
ko04670 4.17e-02
ko04640 4.24e-02
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG00496
CGGGCTCTAAATGCGAAAGAAAGACTAGTAAATGATAAAGCTAGATCATATTTTCACTTGTTTACACCTT
GATTTTCTGATTCTGAGTGTGACCACAGCCATGATTATTGTGTAGTAGCATGATGTCGTGTTTTTGCTGA
AGTGAATGTGAAGCTTAGTGCATCACAGCTGAAAACAGAAGGGATGCTAAGGTCATCCACAATGCTGTTA
GCATACTAGCCAGCACCGGAGACTTGTTGG