LncRNA Gene

ZFLNCG00595

Basic Information

Chromesome: chr1

Start: 53072107

End: 53072462

Transcript: ZFLNCT00860

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR1205151 5dpf transgenic sqET20 and neomycin treated 1h 60.55
SRR1049952 embryo transgenic TgOMP-Gal4 and UAS-GCaMP1.6 and treated with gallein 48.56
SRR1188156 embryo Control PBS 4 hpi 41.00
SRR700534 heart control morpholino 33.03
SRR1205157 5dpf transgenic sqET20 and neomycin treated 1h and GFP+ 32.02
SRR1205166 5dpf transgenic sqET20 and neomycin treated 3h 31.70
SRR1205154 5dpf transgenic sqET20 29.35
SRR1205172 5dpf transgenic sqET20 and neomycin treated 5h 24.85
SRR726540 5 dpf normal 24.58
SRR1205163 5dpf transgenic sqET20 and neomycin treated 3h and GFP+ 23.80
Express in tissues
Correlated coding gene Download
gene correlation coefficent
si:dkey-20i20.2 0.66
zgc:113176 0.65
nr5a1a 0.65
si:dkey-159f12.2 0.64
lamtor1 0.64
zgc:171551 0.63
tmx4 0.59
pgr 0.59
trim35-39 0.59
v-fbpl 0.58
Gene Ontology Download
GO P value
GO:0032439 1.78e-03
GO:0030728 3.55e-03
GO:0007127 5.32e-03
GO:0055129 5.32e-03
GO:0016559 5.32e-03
GO:0006561 7.09e-03
GO:0032008 7.09e-03
GO:0043401 7.97e-03
GO:0032088 8.85e-03
GO:0001919 8.85e-03
GO:0032044 3.55e-03
GO:0071986 8.85e-03
GO:0031231 8.85e-03
GO:0005779 8.85e-03
GO:0031902 2.11e-02
GO:0044439 2.46e-02
GO:0044438 2.46e-02
GO:0045121 3.15e-02
GO:0098857 3.15e-02
GO:0008023 3.67e-02
GO:0004735 5.32e-03
GO:0003707 8.38e-03
GO:0046914 1.12e-02
GO:0005351 1.41e-02
GO:0005402 1.41e-02
GO:0015295 1.76e-02
GO:0008270 2.05e-02
GO:0016864 2.11e-02
GO:0003756 2.11e-02
GO:0016646 2.29e-02
KEGG Pathway Download
KO P value
ko05224 1.48e-02
ko00531 2.53e-02
ko05320 3.18e-02
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG00595
GCTGCAAAGTCTCCACCTTCTTCTGGAAGTATCTATATTTATAGGATCTCTAGTAATCTTGGCTTTAAAT
GCAAAGACATGTTCTGTGTGAATGGCAACTATGATGATCCAATTACAAAGAGTTTGATTATCGATTTTCC
ACTGCTCTTCTGTGATCCGCAGGTGCTTATTAAAGGATTCGGCGTTCATCTTACAGACCTGTGCAATTCC
ACGTCTCTGGAAGAGTTTGTGACTATAGCCGATAAAGACGTGTCTCAACTGACGCAAAACATCATCTGCC
AGTCGCCCGCTGATTGGCTGAACAACGCAGAGCAACACTTCCTGTCCAACCTGGACTTCCTGAAGCCCAT
TCGGG