LncRNA Gene

ZFLNCG00663

Basic Information

Chromesome: chr1

Start: 57141162

End: 57141421

Transcript: ZFLNCT00985

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR891512 blood normal 27.62
SRR592699 pineal gland normal 9.83
SRR516125 skin male and 3.5 year 6.01
SRR726542 5 dpf infection with control 5.66
ERR023146 head kidney normal 5.57
SRR1299125 caudal fin Half day time after treatment 5.55
SRR1299128 caudal fin Three days time after treatment 5.29
SRR1035984 13 hpf normal 4.10
SRR516121 skin male and 3.5 year 4.08
SRR372796 bud normal 3.73
Express in tissues
Correlated coding gene Download
gene correlation coefficent
LOC100148249 0.61
rnf183 0.59
zgc:110333 0.57
si:ch211-95j8.2 0.55
LOC558513 0.55
krt17 0.55
LOC100000832 0.54
btr30 0.54
ch25hl1.1 0.53
si:dkey-17e16.17 0.53
Gene Ontology Download
GO P value
GO:0008150 6.40e-04
GO:0042667 3.12e-03
GO:0021559 4.68e-03
GO:0030910 4.68e-03
GO:0035270 6.24e-03
GO:0009987 8.97e-03
GO:0071698 9.35e-03
GO:0009888 1.24e-02
GO:0008544 1.40e-02
GO:0060429 1.63e-02
GO:0005923 9.06e-07
GO:0070160 9.84e-07
GO:0005911 5.49e-05
GO:0030054 5.78e-04
GO:0099512 2.83e-02
GO:0099513 2.83e-02
GO:0005886 3.44e-02
GO:0005198 2.52e-04
GO:0018688 6.24e-03
GO:0018689 6.24e-03
GO:0009974 6.24e-03
GO:0052613 6.24e-03
GO:0052611 6.24e-03
GO:0052610 6.24e-03
GO:0052612 6.24e-03
GO:0052608 6.24e-03
GO:0052609 6.24e-03
KEGG Pathway Download
KO P value
ko04514 4.62e-03
ko04670 6.19e-03
ko05160 6.35e-03
ko04530 1.37e-02
ko00120 1.65e-02
ko05143 2.64e-02
ko04745 3.12e-02
ko04961 4.81e-02
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG00663
CTGGGTTTGTTTTACTTGAGCTTTTGACTTCACAGCATTAGTTTTCCTCTTGTTGTATGTTGTGATTGTA
TGTTATGGCGTGTGTAACCACTAGATGGCACCAGAGGTTTGGAAAGGGTTATGTGAGATGAGAGAGTGCT
AGAATAAGACAGTATCAGGCAGACTGAACTTGTAAATATAGAAGACACTCGTCCAACTCGTCGTCATTAT
TATAAGACGCAAACATGAGATGGTACCAGAGCATAGCAAGACAAATGCC