LncRNA Gene

ZFLNCG01067

Basic Information

Chromesome: chr2

Start: 29610567

End: 29610938

Transcript: ZFLNCT01539

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
ERR023145 heart normal 343.88
SRR1299126 caudal fin One day time after treatment 239.94
SRR1299124 caudal fin Zero day time after treatment 207.24
SRR1299127 caudal fin Two days time after treatment 198.02
SRR1299129 caudal fin Seven days time after treatment 191.10
SRR1299125 caudal fin Half day time after treatment 181.38
SRR1299128 caudal fin Three days time after treatment 137.84
SRR516123 skin male and 3.5 year 103.03
ERR023143 swim bladder normal 89.48
SRR516121 skin male and 3.5 year 87.68
Express in tissues
Correlated coding gene Download
gene correlation coefficent
si:ch211-105c13.3 0.64
perp 0.63
copz2 0.62
soul2 0.62
sdpra 0.62
LOC100334363 0.62
cldna 0.61
LOC555879 0.61
wu:fb15g10 0.61
LOC100334705 0.60
Gene Ontology Download
GO P value
GO:0009987 4.46e-05
GO:0044237 9.87e-05
GO:0034641 2.13e-04
GO:0006807 2.98e-04
GO:0044260 6.30e-04
GO:0046483 8.82e-04
GO:0006725 8.82e-04
GO:0071698 1.38e-03
GO:1901360 1.73e-03
GO:0006139 1.78e-03
GO:0005911 7.54e-06
GO:0044853 7.27e-05
GO:0005901 7.27e-05
GO:0030054 1.83e-04
GO:0045121 6.62e-04
GO:0098857 6.62e-04
GO:0016021 1.08e-03
GO:0005923 1.30e-03
GO:0030057 1.38e-03
GO:0070160 1.40e-03
GO:0097159 1.03e-06
GO:1901363 1.56e-06
GO:0004859 4.88e-05
GO:0055102 4.88e-05
GO:0003676 6.97e-05
GO:0003674 7.82e-05
GO:0005509 4.41e-04
GO:0005080 5.57e-04
GO:0008418 9.23e-04
GO:0005488 1.91e-03
KEGG Pathway Download
KO P value
ko00590 6.11e-03
ko04217 8.84e-03
ko04060 1.18e-02
ko00512 1.83e-02
ko04916 1.88e-02
ko05412 1.91e-02
ko05100 3.42e-02
ko00564 3.42e-02
ko04623 3.50e-02
ko00281 3.56e-02
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG01067
ATAAAACCAAAGTTTTACTCATTTAAAGACTCAAACAGCAGTGTATATAGTTTGAGTGTATGATACAGTA
TCAGCCTTTGTAGTGGTGTAGTGTAGCATAGCTTTGTATTACACCATTATTGTATTCCTTTAAACAGCTC
ATGTCCGATGCCAAAAAATTAAATATTAGTCTCAATATTGGATATGAAAATAATGTCCTAAATTGCCAAA
CTTACTCCTATGCATGACTTTTAGATATTTAACCATGAACGATGCAAAGGTAAATGCTGTAAATAATACC
TCTGATATTTGTAACGCTGTATAAATTGTACAGAACAATTGTTTGGAAGAAAATGCTTGCCAGAGATGTT
TATCAAATAAAGGGCTTCCAG