LncRNA Gene

ZFLNCG01171

Basic Information

Chromesome: chr2

Start: 37405827

End: 37406242

Transcript: ZFLNCT01699

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
ERR023143 swim bladder normal 200.82
SRR1299125 caudal fin Half day time after treatment 186.66
ERR023146 head kidney normal 157.47
SRR1299129 caudal fin Seven days time after treatment 149.64
SRR1299127 caudal fin Two days time after treatment 141.16
SRR1299126 caudal fin One day time after treatment 132.35
SRR1299124 caudal fin Zero day time after treatment 110.14
SRR1299128 caudal fin Three days time after treatment 97.43
ERR023145 heart normal 54.82
SRR516125 skin male and 3.5 year 44.05
Express in tissues
Correlated coding gene Download
gene correlation coefficent
zgc:73185 0.66
bc2 0.65
hopx 0.64
ntan1 0.64
si:dkey-52k20.13 0.63
crfb2 0.61
chmp4b 0.61
scamp2 0.61
LOC100331646 0.60
arpc4l 0.60
Gene Ontology Download
GO P value
GO:0060326 3.33e-03
GO:0035965 4.12e-03
GO:1990564 4.12e-03
GO:1990592 4.12e-03
GO:0007034 6.31e-03
GO:0090155 8.23e-03
GO:0090153 8.23e-03
GO:0006004 8.23e-03
GO:0071218 8.23e-03
GO:1905038 8.23e-03
GO:0005834 2.25e-04
GO:0010008 6.34e-04
GO:0044440 1.34e-03
GO:0043020 4.12e-03
GO:0098588 9.56e-03
GO:0015629 9.61e-03
GO:0098796 1.14e-02
GO:0031090 1.14e-02
GO:0005768 1.16e-02
GO:0098797 1.93e-02
GO:0042806 4.12e-03
GO:0003847 4.12e-03
GO:0004343 4.12e-03
GO:0004462 8.23e-03
GO:0004904 8.23e-03
GO:0046934 8.23e-03
GO:0005484 1.18e-02
GO:0052813 1.23e-02
GO:0008418 2.04e-02
GO:0016303 2.04e-02
KEGG Pathway Download
KO P value
ko04217 2.92e-06
ko05167 5.96e-05
ko04380 1.20e-04
ko04620 4.80e-04
ko04668 9.54e-04
ko05142 1.29e-03
ko04144 1.39e-03
ko04621 2.57e-03
ko01524 2.75e-03
ko05131 3.41e-03
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG01171
ATACAATTGACGTTGGAGTAAAGATTACAGGTGTCTTAAAACATTTTCATATTTACAATCTACATCACCG
ACTGACTAGTTTCAACACCTGTTGTAACTATTTCTCCTCATCTCTATGGCCCACACATAATATATAAAAC
ATACAGAACAGCTTTTTCATGACACAGATTGACTGAGGAGATTGTCAGAATCTGACATTAGATATTAAAA
ATAACAAATATGTCCCATCTTGGAGCAGTGCAGTAGGAAGTGATCATATGATTACCAACATCACATTTCC
TCATAAAAAAGACTGACAATATAAAAATATTCACATAAGACTCATTCGATCTGTTTCACTGAGAATGCAC
TGGGTTTCAAAACTGTTTACACCACATACAGCAGTTTCATATAAAACAATCAATGTTGTGGTTAT