LncRNA Gene

ZFLNCG01220

Basic Information

Chromesome: chr2

Start: 42064730

End: 42065004

Transcript: ZFLNCT01776

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR516129 skin male and 5 month 12.13
SRR1647684 spleen SVCV treatment 7.95
SRR516135 skin male and 5 month 7.38
SRR1647681 head kidney SVCV treatment 6.65
SRR1647682 spleen normal 5.83
SRR516124 skin male and 3.5 year 5.82
SRR516122 skin male and 3.5 year 5.39
SRR941753 posterior pectoral fin normal 4.34
SRR1647680 head kidney SVCV treatment 3.91
SRR941749 anterior pectoral fin normal 3.63
Express in tissues
Correlated coding gene

Correlated coding gene of this lncRNA gene hava does not exist!

Gene Ontology

Gene Ontology of this lncRNA gene hava does not exist!

KEGG Pathway

KEGG pathway of this lncRNA gene hava does not exist!

Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG01220
TTCACTTAGAACACAAATCTGCTTTGGGTCTTTATCACCCCATTCCATTGGCCAGTCAGTCAGAAGCACT
TGTACCATGTTTACCACACTGTTGACCTCAGCATAATTTAACCATGATGTGGATGTGATGGTGGAACTCA
GATGGCATTCTCCTCTGACATGATGAAAAATCAAGGGTTTTAGCCTCGGGTGTGGATGCACATCTCCTCT
GGCCTTGATCCCATCACTCACATAGAAGTAAGTGGATACAAAATCCACAATTTCTGTGGTCGAG