LncRNA Gene

ZFLNCG01313

Basic Information

Chromesome: chr2

Start: 51371738

End: 51371985

Transcript: ZFLNCT01917

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR592703 pineal gland normal 69.16
SRR592702 pineal gland normal 60.94
SRR592701 pineal gland normal 53.09
SRR516125 skin male and 3.5 year 18.58
SRR748489 egg normal 17.83
SRR1205169 5dpf transgenic sqET20 and neomycin treated 5h and GFP+ 13.95
SRR941753 posterior pectoral fin normal 13.76
ERR594417 retina normal 13.74
SRR516131 skin male and 5 month 13.33
SRR1565819 brain normal 12.39
Express in tissues
Correlated coding gene

Correlated coding gene of this lncRNA gene hava does not exist!

Gene Ontology

Gene Ontology of this lncRNA gene hava does not exist!

KEGG Pathway

KEGG pathway of this lncRNA gene hava does not exist!

Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG01313
AGGTTTGTCTCGAAGAAGGTCCAGTACAAGCTGAGCATAGAGATGCCAGAGGTCTGCAACGGAAGTGACT
GCTCTTCATAGGAAAAACAAGTCACGCACACAGACACACACACTCACACTTCTGTCTTTACCAGGTCACA
GGACTGCTGGTCCAGGGTTACGGCTGCCTAAAAGCCAAAAATGTGATGCTGCTTTCAGTGAGTTGTTTGG
TGAATCTCACTAAATCTGACCAGAACTGGATCCCAGA