LncRNA Gene

ZFLNCG01458

Basic Information

Chromesome: chr3

Start: 2465658

End: 2465916

Transcript: ZFLNCT02148

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR592703 pineal gland normal 15.60
SRR891512 blood normal 15.10
ERR023145 heart normal 11.37
SRR941749 anterior pectoral fin normal 9.05
SRR941753 posterior pectoral fin normal 8.97
SRR1299124 caudal fin Zero day time after treatment 6.14
SRR1299128 caudal fin Three days time after treatment 5.35
SRR1299129 caudal fin Seven days time after treatment 3.56
SRR1299127 caudal fin Two days time after treatment 3.47
SRR1299125 caudal fin Half day time after treatment 3.12
Express in tissues
Correlated coding gene Download
gene correlation coefficent
si:dkey-28d5.3 0.56
LOC100000417 0.54
LOC100000504 0.54
Gene Ontology

Gene Ontology of this lncRNA gene hava does not exist!

KEGG Pathway

KEGG pathway of this lncRNA gene hava does not exist!

Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG01458
GGCAGAAGAAAAAAAATACAAAAGCATGAGACAGAATAAATACGTACAGAACTTAAAATGATATCGACAT
GCAGCTGAAATCAAGAAAGCAAAGAAACATGGGATTTAGAGTGCATACTGTATGTAGTGTTCAACATGGG
CATTACAGCCAAGGGTTGTGACAGGACGTCTGTAGATGTCTGACAGAAATAAAGTCTAACAAGTGAAACT
GCTGATAGTGTTTGTTGAGTTATTTAAAGATCCTCTGTTGAGATTTTG