LncRNA Gene

ZFLNCG01594

Basic Information

Chromesome: chr3

Start: 13103008

End: 13103255

Transcript: ZFLNCT02345

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
ERR023144 brain normal 137.53
SRR1648856 brain normal 92.91
SRR1049946 embryo transgenic TgOMP-Gal4 and UAS-GCaMP1.6 and treated with DMSO 81.49
SRR1048059 pineal gland light 66.44
SRR1049952 embryo transgenic TgOMP-Gal4 and UAS-GCaMP1.6 and treated with gallein 53.20
SRR1648854 brain normal 50.17
SRR372802 5 dpf normal 35.35
SRR1565811 brain normal 19.21
SRR594771 endothelium normal 15.68
SRR800045 muscle normal 15.27
Express in tissues
Correlated coding gene Download
gene correlation coefficent
mmp16a 0.53
LOC101883507 0.51
dixdc1a 0.51
zgc:100906 0.51
magi2 0.51
ptn 0.51
klf7b 0.51
amph 0.51
ahdc1 0.51
gdi1 0.50
Gene Ontology Download
GO P value
GO:0045454 4.61e-04
GO:0060312 8.53e-04
GO:0034103 2.56e-03
GO:0060272 3.41e-03
GO:0021634 3.41e-03
GO:0035143 5.11e-03
GO:0015693 5.11e-03
GO:0021603 8.50e-03
GO:0019725 8.64e-03
GO:0035141 1.10e-02
GO:0014704 5.11e-03
GO:0044291 5.11e-03
GO:0005924 1.10e-02
GO:0005925 1.10e-02
GO:0030055 1.10e-02
GO:0030054 1.89e-02
GO:0005922 2.70e-02
GO:0005802 2.78e-02
GO:0005921 3.19e-02
GO:0098791 3.28e-02
GO:0005093 2.56e-03
GO:0001158 3.41e-03
GO:0035326 4.26e-03
GO:0038036 5.11e-03
GO:0005243 5.11e-03
GO:0005092 6.80e-03
GO:0055077 7.65e-03
GO:0045125 8.50e-03
GO:0003756 1.02e-02
GO:0016864 1.02e-02
KEGG Pathway

KEGG pathway of this lncRNA gene hava does not exist!

Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG01594
TGACTTCTTGAGAAGTCCAAATTCTGGACCCTTCAAGGAGCTCATATAGTCGGTATTTGGAAAATCAACC
ACAGAGGAATGTTATAATGACACTGTTTAAAAAAAGGCGAGCAAGCCGAGGGGCCTTTTGTTCTGAGACA
GCCTGAAAAGAAAATTCATTTCCTGTCTGACAGATTACAGGATTACTAGGGGGAGAAAAAAAAACGCTAC
AAAGGGTACATGAGAAGTCAAAAGTGTCAGTTTTGCT