LncRNA Gene

ZFLNCG01604

Basic Information

Chromesome: chr3

Start: 13611302

End: 13611542

Transcript: ZFLNCT02355

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
ERR023143 swim bladder normal 9253.29
ERR023145 heart normal 1189.92
SRR372802 5 dpf normal 131.85
ERR023146 head kidney normal 89.33
SRR1039571 gastrointestinal diet 0.1 NPM 75.17
SRR957181 heart normal 45.40
SRR1562529 intestine and pancreas normal 36.95
SRR1039573 gastrointestinal diet 0.75 NPM 30.02
SRR516133 skin male and 5 month 27.81
SRR891495 heart normal 23.82
Express in tissues
Correlated coding gene Download
gene correlation coefficent
acta2 0.73
lrrc2 0.70
LOC795335 0.69
myh11a 0.67
sync 0.66
xpnpep2 0.66
tagln 0.65
ctsbb 0.65
cox6a2 0.65
pdk2 0.64
Gene Ontology Download
GO P value
GO:0055114 1.89e-09
GO:0044260 2.20e-09
GO:1901565 1.02e-07
GO:0016054 1.72e-07
GO:0046395 1.72e-07
GO:0006629 1.92e-07
GO:0032787 5.10e-07
GO:0071840 6.32e-07
GO:0006631 6.84e-07
GO:0016043 1.22e-06
GO:0043229 2.76e-08
GO:0005634 1.05e-07
GO:0043226 1.43e-07
GO:0043231 4.69e-06
GO:0043228 9.88e-06
GO:0043232 9.88e-06
GO:0043227 3.23e-05
GO:0044424 4.06e-05
GO:0044464 6.19e-05
GO:0044428 8.77e-05
GO:0016491 7.89e-11
GO:0003824 1.99e-08
GO:0003676 3.60e-08
GO:0004252 3.90e-07
GO:0008236 3.01e-06
GO:0017171 3.01e-06
GO:0005506 5.91e-06
GO:0020037 1.02e-05
GO:0008131 1.21e-05
GO:0046906 1.46e-05
KEGG Pathway Download
KO P value
ko00120 7.91e-08
ko00380 6.45e-06
ko00100 5.16e-05
ko03320 7.24e-05
ko00071 2.75e-04
ko00360 3.22e-04
ko00350 4.94e-04
ko04974 7.22e-04
ko04260 8.28e-04
ko00950 8.98e-04
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG01604
TTTATTCGTTTTTTATATGCTCAGCCATTGTTGGTAAGCCTCATAAATAAAGACATTTGAAGGAGGAGGG
ATGCATTGTATCACTTTCAATGGGAAACTAAAGTAAGATTCGCTGTTTTATGGTCTTGAGTTACTGTAAC
AGAGCTCACATCAGTCATAAACAACACATTTCTGGATTATACATTGTTGTTGCTCTGATCATTGAGCTTT
AAACATGAGAATTTTGCAAACACAAAAGTT