LncRNA Gene

ZFLNCG01663

Basic Information

Chromesome: chr3

Start: 19324700

End: 19324934

Transcript: ZFLNCT02433

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR941753 posterior pectoral fin normal 55.57
SRR941749 anterior pectoral fin normal 42.87
SRR516124 skin male and 3.5 year 39.84
SRR592701 pineal gland normal 33.50
SRR1028002 head normal 31.38
SRR592699 pineal gland normal 27.70
SRR516130 skin male and 5 month 20.21
SRR516131 skin male and 5 month 19.83
SRR527834 head normal 18.48
SRR516126 skin male and 5 month 16.21
Express in tissues
Correlated coding gene Download
gene correlation coefficent
LOC100004545 0.62
ccr6b 0.55
si:dkeyp-75b4.8 0.54
LOC100332938 0.53
hpdb 0.52
zgc:172271 0.52
LOC100149947 0.52
si:busm1-71b9.3 0.51
ponzr10 0.51
LOC101883339 0.51
Gene Ontology Download
GO P value
GO:0009072 9.63e-03
GO:0055072 1.53e-02
GO:0055076 1.86e-02
GO:0044424 2.65e-02
GO:0003868 1.14e-03
GO:0016702 1.13e-02
GO:0016701 1.19e-02
GO:0051213 2.81e-02
KEGG Pathway Download
KO P value
ko00130 3.05e-03
ko00360 4.71e-03
ko00350 9.14e-03
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG01663
TCTGATGTTGTGATCTACTTGGGACGTCAGACCAGAAATGGCTCAAACCCACATGAGATACCCAGGACAG
TGATTCAAGTCATCAATCATCCTAAAGATAACAGTTTCACCAACAGTATAGCACTTGTCCAGCTCTCTTC
CTCCGTGACTTTCACTGATTACATTAGGCCAGTGTGTCTGGCTGCTGCTGGTAGTGTGTTTGTTGACGGG
ACAGAGAGTTGGGTCACTGGCTGG