LncRNA Gene

ZFLNCG02997

Basic Information

Chromesome: chr4

Start: 62013429

End: 62013705

Transcript: ZFLNCT04579

Known as: ENSDARG00000097632

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
ERR023144 brain normal 103.73
ERR023143 swim bladder normal 28.18
SRR372802 5 dpf normal 10.07
ERR023146 head kidney normal 9.28
SRR372800 2 dpf normal 5.04
SRR527833 5 dpf normal 4.17
SRR038626 embryo control morpholino and bacterial infection 3.89
SRR519727 6 dpf FETOH treatment 3.44
SRR1188156 embryo Control PBS 4 hpi 2.57
SRR1342216 embryo norml 2.32
Express in tissues
Correlated coding gene

Correlated coding gene of this lncRNA gene hava does not exist!

Gene Ontology

Gene Ontology of this lncRNA gene hava does not exist!

KEGG Pathway

KEGG pathway of this lncRNA gene hava does not exist!

Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG02997
CTGATTATGAAGGGGAGGAGCTACTGATGAAGGGGGAGCTGTTTAAGAAAGGGGAGGAGGTGATTATGAA
GAGGAGGAGCTACTGATGAAGGGAGAGCTGTTGTAGAAAGGGGAGGAGCTGATTATGAAGGAGAGGAGCT
ACTGATGAAGGGAGAGCTGTTGAAGAAAGGGGAGGAGTTGATTATGAAGAGGAGGGGCTACTGATGATGA
AGGGGAGGAGCTACTGATGAAGGGAGAGCTGTTGAAGAAAGGGGAGGAGGTGATTATGAAGAGGGG