LncRNA Gene

ZFLNCG03083

Basic Information

Chromesome: chr5

Start: 9566271

End: 9566482

Transcript: ZFLNCT04732

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR516124 skin male and 3.5 year 305.48
SRR516121 skin male and 3.5 year 228.68
SRR516127 skin male and 5 month 226.88
SRR516123 skin male and 3.5 year 216.60
SRR516133 skin male and 5 month 200.51
SRR516128 skin male and 5 month 196.73
SRR516122 skin male and 3.5 year 187.13
SRR516125 skin male and 3.5 year 180.87
SRR516129 skin male and 5 month 178.76
SRR516130 skin male and 5 month 177.13
Express in tissues
Correlated coding gene Download
gene correlation coefficent
si:ch211-12e13.10 0.62
LOC797575 0.58
zgc:136605 0.55
LOC799658 0.55
LOC101887028 0.55
LOC793256 0.55
LOC100330113 0.54
LOC100329690 0.54
LOC101885154 0.53
LOC100331025 0.53
Gene Ontology Download
GO P value
GO:0045065 4.26e-04
GO:0002456 8.53e-04
GO:0002449 1.28e-03
GO:0002460 2.13e-03
GO:0006955 2.52e-03
GO:0002443 2.98e-03
GO:0002376 4.89e-03
GO:0030217 6.38e-03
GO:0002250 8.08e-03
GO:0030098 9.35e-03
GO:0042613 4.26e-03
GO:0009897 5.11e-03
GO:0098552 5.53e-03
GO:0042611 6.38e-03
GO:0044459 4.50e-02
GO:0004707 8.08e-03
GO:0004702 2.91e-02
GO:0005057 4.31e-02
KEGG Pathway Download
KO P value
ko04660 8.71e-04
ko04611 1.50e-03
ko04015 4.34e-03
ko05340 1.24e-02
ko04139 1.53e-02
ko04624 2.03e-02
ko04011 2.19e-02
ko04622 2.56e-02
ko04640 2.64e-02
ko05014 3.05e-02
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG03083
TTAAACCAAAGATTTGAAACAATGCACAGAAGTGTAACGTTTTAAAGCTAATTGTTATAGTAGTCTAATT
TTAACAGCTCGTGATATTCAATGTAATCACTCTTGAGACCTGCCAAATGTTGTCATTAACCCTTGTGTGC
TGTTGGGGATAATTTCGAGTCTTAATTTGGCCACAACTTTCACCGTGTCAGCAAAATTTAATGCTTTTTG
G