LncRNA Gene

ZFLNCG03128

Basic Information

Chromesome: chr5

Start: 14820440

End: 14820875

Transcript: ZFLNCT04812

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR1299125 caudal fin Half day time after treatment 35.89
ERR023143 swim bladder normal 32.76
SRR1562529 intestine and pancreas normal 25.09
SRR941749 anterior pectoral fin normal 21.57
SRR1299129 caudal fin Seven days time after treatment 17.14
SRR941753 posterior pectoral fin normal 16.94
SRR1562531 muscle normal 14.91
SRR516128 skin male and 5 month 14.01
SRR1028003 head normal 12.07
SRR957180 heart 7 days after heart tip amputation 11.45
Express in tissues
Correlated coding gene Download
gene correlation coefficent
LOC101885516 0.80
creg2 0.67
ucmaa 0.66
dnajc4 0.65
tuft1a 0.64
calcoco2 0.64
timp2a 0.64
mhc1zba 0.63
LOC100005026 0.63
si:ch73-52p7.1 0.63
Gene Ontology Download
GO P value
GO:0032502 3.40e-06
GO:0009755 3.51e-06
GO:0044763 6.16e-06
GO:0071840 7.34e-06
GO:0043401 8.86e-06
GO:0016043 1.29e-05
GO:0044767 3.44e-05
GO:0009987 4.37e-05
GO:0048646 4.76e-05
GO:0033993 6.62e-05
GO:0044422 3.09e-06
GO:0044446 7.15e-06
GO:0032991 1.44e-05
GO:0044424 4.50e-05
GO:0044464 8.60e-05
GO:1990904 2.76e-04
GO:0030529 2.76e-04
GO:0005576 3.05e-04
GO:0043228 7.45e-04
GO:0043232 7.45e-04
GO:0003707 1.79e-06
GO:0005035 1.88e-05
GO:0005031 1.88e-05
GO:0001071 2.92e-05
GO:0003700 2.92e-05
GO:0004879 7.24e-05
GO:0098531 7.24e-05
GO:0046914 8.95e-05
GO:0004252 9.91e-05
GO:0008236 4.79e-04
KEGG Pathway Download
KO P value
ko00120 7.35e-06
ko04710 1.05e-05
ko04060 2.69e-05
ko00362 3.10e-04
ko05164 3.23e-04
ko05145 3.53e-04
ko00052 1.36e-03
ko04917 1.62e-03
ko04380 2.18e-03
ko04672 2.31e-03
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG03128
TTTTTTTCTGAATCAAAAAATAATGAAAAAATATCCTATTTCACATCTCACGCACGGACCTGCTTGGACA
ACACTGGAATACATCAAATCCGGTCGTCTGGTCGCATACGGTTAAGTCGCAGGAGTTCAAATATTTCAAT
GTGTCCGCAGCTCAAATCAGATCTGAATTTTCCGCATAAGAAGATGATGGGAAGTCCCGGATTACTCTCT
ATTGGAAATGATTGACTTCCGGACTGTCGCTTGTCATATGCAGTGGAAAGGCGGCTTTAAAAGGAATGGG
AGATGAATGGTTTAATTCACGTAGTGCTCAAAACACACCCATAACTCATTAGGAGTATAAGCACAACCCT
GTTTGACCATGCGCCAGGGAGCAAACCATATTTTCAGACACACCCTCAATGCTTTTGCAACATGCACTTT
AGACTTAAAGCCCTA