LncRNA Gene

ZFLNCG03223

Basic Information

Chromesome: chr5

Start: 25963842

End: 25964130

Transcript: ZFLNCT04953

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR957181 heart normal 50.13
SRR957180 heart 7 days after heart tip amputation 47.24
ERR023145 heart normal 12.93
ERR145646 skeletal muscle 32 degree_C to 27 degree_C 11.98
SRR800045 muscle normal 11.17
SRR1104059 heart kctd10 mut 10.22
SRR891495 heart normal 9.12
SRR1104058 heart normal 6.93
SRR658539 bud Gata5/6 morphant 6.54
ERR145648 skeletal muscle 27 degree_C to 27 degree_C 6.51
Express in tissues
Correlated coding gene Download
gene correlation coefficent
zdhhc23a 0.65
gmpr 0.58
adora1 0.57
wu:fc38h03 0.57
si:dkey-257h21.2 0.54
phkg1b 0.53
dhrs7cb 0.52
cdnf 0.51
homer1b 0.51
tmem255a 0.50
Gene Ontology Download
GO P value
GO:0006073 5.53e-05
GO:0044042 5.53e-05
GO:0005977 5.53e-05
GO:0006112 6.87e-05
GO:0044264 7.59e-05
GO:0005976 9.14e-05
GO:0015980 1.90e-04
GO:0055114 2.19e-04
GO:0044262 3.09e-04
GO:0006091 1.26e-03
GO:1902560 1.28e-03
GO:0005964 2.56e-03
GO:1902554 1.46e-02
GO:1902911 1.71e-02
GO:1990204 2.09e-02
GO:1902494 2.90e-02
GO:0005576 3.46e-02
GO:0061695 4.94e-02
GO:0035256 6.40e-04
GO:0003920 1.28e-03
GO:0016657 1.28e-03
GO:0018448 1.92e-03
GO:0018449 1.92e-03
GO:0018446 1.92e-03
GO:0018447 1.92e-03
GO:0042469 1.92e-03
GO:0034871 1.92e-03
GO:0034582 1.92e-03
KEGG Pathway

KEGG pathway of this lncRNA gene hava does not exist!

Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG03223
TTTCACTAAAGTTTTAAATGGTATCATCGTCAATGTAGTTCAAAGTAAGGCTCAAGATAGAGTCCATCGT
CCTACTTGACCGGAGATCAGATGTGGCTGTAAAGTGAAGAAGTAAAAATCACCCAGAGCCTTTAACAGAG
CGGGGTCACGTCACTCGTAGGGAAAGTAATTGAAAAAAAATCGTCCTGGAAAAATTAGATGGATTATAGG
TTCTGAATGTCGATTAATTGCCCAGCCCTAGCTGGTAGCCATTGACTTGATTATATGAACCACCAAGGAC
CCCAGTTT