LncRNA Gene

ZFLNCG03447

Basic Information

Chromesome: chr5

Start: 45890489

End: 45890712

Transcript: ZFLNCT05273

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
SRR592700 pineal gland normal 52.07
SRR592701 pineal gland normal 41.16
SRR1299127 caudal fin Two days time after treatment 26.16
SRR1299126 caudal fin One day time after treatment 21.74
SRR941753 posterior pectoral fin normal 20.22
SRR1299124 caudal fin Zero day time after treatment 19.42
SRR941749 anterior pectoral fin normal 18.23
SRR1299128 caudal fin Three days time after treatment 17.63
SRR1299125 caudal fin Half day time after treatment 17.44
SRR1562529 intestine and pancreas normal 16.99
Express in tissues
Correlated coding gene Download
gene correlation coefficent
golph3l 0.64
si:ch211-130m23.2 0.61
LOC101882273 0.61
LOC567549 0.61
si:ch73-337l15.2 0.61
trpm4c 0.60
b4galt4 0.60
gfpt2 0.60
LOC100536813 0.60
LOC100536528 0.60
Gene Ontology Download
GO P value
GO:0042667 5.31e-05
GO:0021559 1.58e-04
GO:0030910 1.58e-04
GO:0016337 3.14e-04
GO:0035270 3.15e-04
GO:0098602 3.33e-04
GO:0009987 4.62e-04
GO:0044237 5.06e-04
GO:0008544 1.85e-03
GO:0030916 2.80e-03
GO:0005911 4.62e-09
GO:0030054 3.16e-07
GO:0005923 1.44e-06
GO:0070160 1.63e-06
GO:0030057 7.50e-06
GO:0044446 1.29e-04
GO:0044422 1.29e-04
GO:0032991 6.73e-04
GO:0043234 2.03e-03
GO:0005622 4.32e-03
GO:0004859 2.08e-05
GO:0055102 2.08e-05
GO:0005543 3.75e-03
GO:0005544 3.80e-03
GO:0005198 6.72e-03
GO:0008289 7.28e-03
GO:0031683 1.21e-02
GO:0003924 1.41e-02
GO:0050577 1.46e-02
GO:0004360 1.46e-02
KEGG Pathway Download
KO P value
ko00601 2.42e-04
ko00460 1.02e-03
ko00430 1.68e-03
ko00533 1.94e-03
ko00511 5.81e-03
ko05143 8.72e-03
ko04745 1.22e-02
ko00513 1.47e-02
ko04514 1.94e-02
ko00480 2.45e-02
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG03447
CTGTTTTCACTTTGCACTTTACGTGTCTGCCCATTTCACTGGCCTGATTTGACAAGGGGGCTGAGTCAAG
GGAACCTGTGTGTTCACGGCAGGCCCAGACCTGTCACCATTTAAGCAACGTCATAAACTGGAGACACTGT
TACACTGAGGTGGTCTTACAGCTCAGGCCTGCTGTAAACTTCCAAGTTCCCAACATAAGTGCAAAGTGTG
AACAGCATCGCAA